We narrowed to 19,730 results for: puro
-
Plasmid#246913PurposeLentiviral-based expression of EGFP with an ER retention signal sequence and Q185N N186C, an STT3B-specific glcosylation sequonDepositorInsertEGFP
UseLentiviralTagsER signal sequence and KDEL ER retention sequenceExpressionMammalianMutationQ185N N186C STT3B-specific sequon to allow for fl…PromoterCMVAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Puro-CAG-JEDI-2Psub
Plasmid#247186PurposeGenetically encoded voltage indicator (GEVI) JEDI-2Psub expressed under strong mammalian promoter (CAG)DepositorInsertJEDI-2Psub
ExpressionMammalianPromoterCAGAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ35-EZ-Tet-pLKO-shNKX3.1-Puro
Plasmid#131078Purposeinducible NKX3-1 knock downDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ22-AAVS1-Puro-CAG-ASAP2f
Plasmid#131066PurposeDonor plasmid of targeted ASAP2f knockinDepositorInsertASAP2f
UseCRISPRExpressionMammalianAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ09-lenti-EF1a-NKX6.1-puro
Plasmid#131054PurposeForced expression of NKX6.1DepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK036C_AttB_mkozak_mGreenLantern-STIM1_IRES_mCherry-H2A-P2A-PuroR
Plasmid#232938PurposeLow expression plasmid of STIM1 with N-terminal mGreenLantern tag for Matreyek Bxb1 (GT) landing padDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-EF1A-hOGG1/Myc
Plasmid#187034PurposeA myc tag fused to the C-terminus of OGG1 and a puromycin resistance cassetteDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTWIST CMV Puro EPB41L4A ORF
Plasmid#242647PurposeExpresses EPB41L4A in mammalian cellsDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA eBAR3-SV40-puro
Plasmid#240537PurposeLentiviral eBAR3 backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA-eBAR3
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA eBAR2-SV40-puro
Plasmid#240536PurposeLentiviral eBAR2 backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA-eBAR2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-PURO-RAC1-R66A
Plasmid#241369PurposeLentiviral expression of mutant Rac1DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-PURO-RAC1-Y64F
Plasmid#241370PurposeLentiviral expression of mutant Rac1DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-E14-ABE-Cas9n-puro
Plasmid#226588PurposeExpress E14-ABE in mammalian cellsDepositorInsertE14-ABE
UseCRISPRExpressionMammalianAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-chGrb2/eDHFR(69K6)-iRFP713
Plasmid#214828PurposeEncoding Grb2-eDHFR(69K6) chimera fused to iRFP713DepositorInsertGrb2(1-59)-eDHFR(69K6)-Grb2(152-216)-iRFP713
TagsiRFP713ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SV40-puro-EF1a-HA-NLGN1dAChE-bc
Plasmid#220437PurposeExpresses HA-tagged human NLGN1 with K578A/V579A substitutionsDepositorInsertNeuroligin-1 (NLGN1 Human)
UseLentiviralTagsHA-tagExpressionMammalianMutationK578A and V579A substitutionsPromoterEF1aAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP(N55D)-CNOT7-V5H6.MCh.Puro
Plasmid#209949PurposeIn mammalian cells expresses non-binding TP mutant fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) with a N55D mutation that i…ExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7-V5H6.MCh.Puro
Plasmid#209936PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209940PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6NOT1interaction)-V5H6.MCh.Puro
Plasmid#209941PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 or NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1 and CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only