We narrowed to 11,416 results for: Dos
-
Plasmid#246533PurposePlant co-editing vectorDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterCmYLCVAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
PhoCoil
Plasmid#220444PurposeA plasmid encoding a photodegradable hydrogel-forming protein PhoCoilDepositorInsertPhoCoil
Tags6x His (N and C term)ExpressionBacterialPromoterT7Available SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-RBAP46/RBBP7
Plasmid#109210PurposeEncodes human full-length RBBP7 (aka RBAP46) to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA1-Filler-v1
Plasmid#237399PurposeFor inserting a single guide RNA or later cloning two U6-gRNA cassettes with MIGR1-U6gRNA1-Filler-v2.DepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianPromoterU6, PGKAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Human
Plasmid#232149PurposeMPS1 from Human codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1 (TTK Human)
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDW108
Plasmid#227194PurposeTemplate for multi-nucleosome arrayDepositorInsert64mer array of p601 with 50bp flanking naked DNA between the anchor points and the first and the last 601.
ExpressionBacterialPromoterPlacAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-K.l.LEU2
Plasmid#229229PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-TRP1
Plasmid#229228PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA498
Plasmid#231119PurposeFragmid fragment: (guide cassette) ABE activity-based selection CD274 positive controlDepositorInsertsgCD274 + ABE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA505
Plasmid#231120PurposeFragmid fragment: (guide cassette) CBE activity-based selection CD274 positive controlDepositorInsertsgCD274 + CBE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTBY1-T4gp61/41 fusion
Plasmid#228210PurposeExpression in BL21(DE3) of T4 primase and helicase fusion with 24 amino acid linkerDepositorInsert61/41
TagsSce VMA intein-chitin binding domainExpressionBacterialPromoterT7Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV302
Plasmid#204973PurposeAMA1 plasmid with Aspergillus optimized Mad7 and nat1 resistance markerDepositorInsertsMad7
nat1
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and Aspergillu…Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV299
Plasmid#204967PurposeAMA1 plasmid with Aspergillus optimized Mad7 and argB selection markerDepositorInsertsMad7
argB
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and native pro…Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBa.PEX 1-42-tdTM-FKBP
Plasmid#224415PurposeMammalian expression of Pex3DepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
RT-4
Plasmid#220443PurposeConstruct used to generate the PUF3/PUP2/3HA tagging strains. Surrounding the PUP2/3HA/URA3 are large regions of homology to integrate at the 3’ end of the PUF3 gene.DepositorAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV hSyn mRuby
Plasmid#220912PurposeNeuronal specific expression of mRubyDepositorInsertmRuby
UseAAVExpressionMammalianPromoterhSynAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH3.1-GS3
Plasmid#204762PurposeExpression of Cas9 and human H3.1DepositorInsertH3.1 (H3C6 Human)
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only