We narrowed to 4,329 results for: biorxiv
-
Plasmid#225701PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mTurquoise fused BlasticidinRDepositorUseLentiviralTags3xAID HA and T2A-mTurquoiseExpressionMammalianMutationPromoterAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF160_VSV-G
Plasmid#225963PurposeCMV-Intron-VSVG (env protein). Expresses VSV-G env for VLP production.DepositorInsertCMV-Intron-VSVG (env protein)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg2 hp
Plasmid#218094PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIIDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBOB-CAG-SARS-CoV2-Spike D614G-HA
Plasmid#158761Purpose3rd Generation lentiviral vector expressing the codon optimized SARS-CoV2 Spike Glycoprotein D614G high infectivity mutant with a C-terminal HA tag generated by Junko Ogawa & Gerald M PaoDepositorInsertSARS-CoV2 Spike Glycoprotein (S SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID))
UseLentiviralTagsHAExpressionMammalianMutationSpike D614GPromoterCAGAvailable sinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorInsertsgRNA targeting DNA-PKcs (PRKDC) exon 1 (PRKDC Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c020
Plasmid#175489PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be used for crystallography.DepositorInsertSYK (SYK Human)
UseTagsHis6-TEVExpressionBacterialMutationPromoterAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCF140_Gag-SpyCas9-NLS
Plasmid#225959PurposeCMV-Intron-Gag-SpyCas9-NLS. Expresses Gag-SpyCas9-NLS for VLP production.DepositorInsertCMV-Intron-Gag-SpyCas9-NLS
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1314-AAV-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223159PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-pTau nanobody (A2) with sortase tag
Plasmid#233218PurposeMammalian epression of anti-pTau nanobody (A2) with a sortase tag for direct dye conjugation.DepositorInsertAnti-pTau nanobody (A2)
UseTagsSortase tag, His tagExpressionMammalianMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-Actin-Vhh-sfGFP-P2A-1xHA-tdiRFP-caax (JDW 1311)
Plasmid#224497PurposeGateway compatible middle entry clone containing an Actin nanobody fused to sfGFP followed by P2A and tdiRFP-caax tag (GFP actin reporter and cell membrane iRFP reporter)DepositorInsertActin-Vhh-sfGFP-P2A-HA-tdiRFP-caax
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1304-AAV-EFSNC-dCjCas9-KRAB-MECP2
Plasmid#223149PurposeExpression of KRAB and truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(WT)-3AID-HA-2A-mCherryBSD
Plasmid#225697PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationPromoterAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRTagsExpressionMammalianMutationD10APromoterCMVd1Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg1 hp
Plasmid#218093PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1303-AAV-EFSNC-dCjCas9-MECP2(204-310)
Plasmid#223148PurposeExpression of truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_122
Plasmid#208095PurposePerturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seqDepositorInsertPuromycin resistance
UseCRISPR and LentiviralTagsExpressionMutationPromoterEF1aAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pExp-RBD-CHis
Plasmid#195002PurposeProduction of SARS-CoV2 receptor binding domain in E. coli with C-terminal Avi-tagDepositorInsertRBD (S SARS-CoV-2)
UseTagsHis8ExpressionBacterialMutationPromoterT7lacAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorArticleInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only