We narrowed to 21,347 results for: grn
-
Plasmid#53061PurposeTranscription of guide RNA (gRNA) in maize cellsDepositorInsertzmU3 promoter - gRNA
UseCRISPR; Plant expressionPromotermaize U3Available SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-HNRNPD_sgRNA1
Plasmid#201598PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertHNRNPD (HNRNPD Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCfB3042(gRNA X-4)
Plasmid#73284PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPbuCas13b-gRNA-NT
Plasmid#184568PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for PbuCas13b in bacteria.DepositorInsertConstitutive expression of single-spacer CRISPR array witha nontargeting spacer for PbuCas13b in bacteria.
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-GPI_sgRNA1
Plasmid#201594PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertGPI (GPI Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago2_3
Plasmid#73531PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA2
Plasmid#201591PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
TU6m-gRNAscaffHygroR
Plasmid#165485PurposeS. pyogenes Cas9 guide RNA expression in tilapia cellsDepositorTypeEmpty backboneUseCRISPRPromoterOreochromis mossambicus U6Available SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago2_4
Plasmid#73532PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197981PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by UBQ10 gene promoter, flanked by ribozymes.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AagRNA
Plasmid#121953PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b tracrRNA/crRNA duplex
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-HK2_sgRNA2
Plasmid#201597PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertHK2 (HK2 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Construct 10 - U6p_40nt_stgRNA
Plasmid#81249PurposeExpresses 40nt stgRNADepositorInsertsgRNA
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRRAP sgRNA1
Plasmid#138182Purpose3rd generation lentiviral gRNA plasmid targeting human TRRAPDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRRAP sgRNA2
Plasmid#138183Purpose3rd generation lentiviral gRNA plasmid targeting human TRRAPDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PABPC1_sgRNA1
Plasmid#201608PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPABPC1 (PABPC1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA2
Plasmid#68465Purposetargeting PAX6 geneDepositorAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB3041(gRNA X-3)
Plasmid#73283PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-3DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only