We narrowed to 27,470 results for: tat
-
Plasmid#44525DepositorInsertP(GAL10)-HHT2 P(GAL1)-HHF2
UseTagsExpressionYeastMutationPromoterGAL 10Available sinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Rbfox3
Plasmid#240299PurposeKI:Lmnb1 Donor:3xV5 KO:NeuNDepositorInsertKI gRNA for Lmnnb1
UseAAVTagsExpressionMutationNAPromoterAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/MYB60
Plasmid#140408PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana MYB60 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana MYB60 and Cauliflower mosaic virus 35SAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CAB3
Plasmid#140410PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CAB3 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana CAB3 and Cauliflower mosaic virus 35SAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1A
Plasmid#140411PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1A promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana CURT1A and Cauliflower mosaic virus 3…Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1B
Plasmid#140412PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1B promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana CURT1B and Cauliflower mosaic virus 3…Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1C
Plasmid#140413PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1C promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana CURT1C and Cauliflower mosaic virus 3…Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1D
Plasmid#140414PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1D promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana CURT1D and Cauliflower mosaic virus 3…Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/35S
Plasmid#140415PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the CaMV35S promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana UBQ10 and Cauliflower mosaic virus 35…Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/PGC1
Plasmid#140416PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana PGC1 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana PGC1 and A. thaliana UBQ10Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/MYB60
Plasmid#140417PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana MYB60 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana MYB60 and A. thaliana UBQ10Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CAB3
Plasmid#140419PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CAB3 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana CAB3 and A. thaliana UBQ10Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1A
Plasmid#140420PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1A promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana CURT1A and A. thaliana UBQ10Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1B
Plasmid#140421PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1B promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana CURT1B and A. thaliana UBQ10Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1C
Plasmid#140422PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1C promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana CURT1C and A. thaliana UBQ10Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1D
Plasmid#140423PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1D promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana CURT1D and A. thaliana UBQ10Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/UBQ10
Plasmid#140406PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana UBQ10 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana UBQ10 and Cauliflower mosaic virus 35SAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/PGC1
Plasmid#140407PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana PGC1 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana PGC1 and Cauliflower mosaic virus 35SAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorInsertVRG4 gRNA (VRG4 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorInsertSAM50 gRNA (SAM50 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only