We narrowed to 2,429 results for: dap
-
Plasmid#204075PurposeType 0 promoter partDepositorInsertphlF repressor and PPhlF DAPG-inducible promoter
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBP-P_TALEsp1_PUPsp1-phlF_PPhlF
Plasmid#204080PurposeType 0 promoter partDepositorInsertTALEsp1-stabilized promoter driving phlF repressor; PPhlF DAPG-inducible promoter
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
mr-GST full length
Plasmid#112982PurposeFor protein expression and purification of full-length Drosophila mr (APC2)DepositorInsertmr (APC2) (mr Fly)
ExpressionBacterialAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-TRAM-CFP
Plasmid#13027DepositorAvailable SinceNov. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pOpen-K12polLF (exo-)
Plasmid#165522PurposeDNA pol fragment used in flourescent labelling for microarray, dA and dT tailing, and ligating DNA adapters to DNA fragments.DepositorInsertDNA Polymerase I, Large (Klenow) Fragment (3'-5' exo-)
UseSynthetic BiologyAvailable SinceDec. 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTHAP12-donor
Plasmid#176348PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
mr-GST N-term fusion
Plasmid#112983PurposeFor protein expression and purification of N-terminus of Drosophila mr (APC2)DepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
AbVec_IGHC
Plasmid#183701PurposeEncode human IgG1 heavy chain constant region. For cloning variable region and mAb expression.DepositorAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only