We narrowed to 6,374 results for: KIT;
-
Plasmid#209859PurposeDimerization dependent fluorescent protein GA fused to NESDepositorInsertddGFP A
TagsNES sequence LALKLAGLDIGSExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
LD-GA
Plasmid#209862PurposeDimerization dependent fluorescent protein GA anchored to cytosolic face of the lipid droplet membrane with hairpin domain of human GPAT4DepositorInsertddGFP A
TagsHairpin domain of GPAT4 MNFQYISLRLTVLWGLGVLIRYCFL…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cyto-B
Plasmid#209858PurposeDimerization dependent fluorescent protein B fused to NESDepositorInsertddGFP B
TagsNES sequence LALKLAGLDIGSExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PM-GA
Plasmid#209877PurposeDimerization dependent fluorescent protein GA anchored to cytosolic face of the plasma membrane with the N-terminal targeting sequence of human GAP43DepositorInsertddGFP A
TagsTargeting domain of Gap43 MLCCMRRTKQVEKNDDQKIExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT3T4
Plasmid#50595PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-26t plus, OsU3p, T4
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRA110
Plasmid#209343PurposeGateway cloning compatible binary vector for agrobacterium mediated transformation. Arabidopsis UBQ10 promoter expression of N-terminal mStayGold fusion protein.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTK305
Plasmid#66812PurposeIVT vector for Fluc mRNADepositorInsertFirefly luciferase
UseLuciferase; Mrna ivtPromoterT7Available SinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXTK024 [Origin_RSF1010_PartType1]
Plasmid#229261PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains Origin_RSF1010_PartType1DepositorInsertRSF1010 Origin
ExpressionBacterialAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Opto-zFGFR1a
Plasmid#232639PurposeZebrafish FGFR1a receptor kinase domain fused to VfLOVDepositorInsertzFGFR1a kinase domain + VfLOV domain
Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A1110
Plasmid#91031PurposeModule A, Promoter: ZmUbi, Gene: TaCas9, Terminator: HSPDepositorInsertTaCas9
UseCRISPRPromoterZmUbiAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEFIRES-P-mCherry-HPos
Plasmid#87159PurposeFluorescent marker of lipid droplets (LDs)DepositorInsertHPos
TagsmCherryExpressionMammalianPromoterEF-1-alphaAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PM-RA
Plasmid#209878PurposeDimerization dependent fluorescent protein RA anchored to cytosolic face of the plasma membrane with the N-terminal targeting sequence of human GAP43DepositorInsertddRFP A
TagsTargeting domain of Gap43 MLCCMRRTKQVEKNDDQKIExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
MAC_C_INSR
Plasmid#187772PurposeMAC-tagged gene expression of human INSRDepositorInsertINSR (INSR Human)
ExpressionMammalianAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
mc2 mNeon
Plasmid#206218PurposeFor expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
MTK1_008
Plasmid#123671PurposeEncodes ConLS and chicken hypersensitivity site 4 insulator as a Type 1 part to be used in the MTK systemDepositorInsertConnector LS-2xHS4
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSW181 - GR-LhG4
Plasmid#115983Purposeentry vector for GreenGate cloning method, CDSDepositorInsertGR-LhG4
UseUnspecifiedAvailable SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only