We narrowed to 20,614 results for: ace
-
Plasmid#193136PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA3 (GB1724) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G3aG2b.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2889
Plasmid#193127PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3272
Plasmid#193134PurposeA2 Proximal promoter sequence consisting of the target sequence for the gRNA1 (GB1838) at "b site" (-210 from TSS).DepositorInsertGB_SynP (A2) G1b.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2891
Plasmid#193128PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2885
Plasmid#193123PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2879
Plasmid#193116PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3278
Plasmid#193132PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3273
Plasmid#193135PurposeA2 Proximal promoter sequence consisting of the target sequence for the gRNA1 (GB1838) at "e site" (-320 from TSS).DepositorInsertGB_SynP (A2) G1e.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_Cep41-STf
Plasmid#182010PurposeCMV overexpression of SNAP-tag fast in mammalian cell lines associated to microtubulesDepositorInsertCep41-STf
ExpressionMammalianMutationFast mutation on SNAP-tag E30RPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_H2B-STf
Plasmid#181998PurposeCMV overexpression of SNAP-tag fast fusion to H2B for nuclear localization in mammalian cell linesDepositorInsertH2B-STf
ExpressionMammalianMutationFast mutation on SNAP-tag E30RPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_[Cox8a]x2_STf
Plasmid#182003PurposeCMV overexpression of SNAP-tag fast in the mitochondrial matrix of mammalian cell linesDepositorInsert[Cox8a]x2_STf
ExpressionMammalianMutationFast mutation on SNAP-tag E30RPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_CalR_STf_KDEL
Plasmid#182004PurposeCMV overexpression of SNAP-tag fast in the endoplasmic reticulum of mammalian cell linesDepositorInsertCalR_STf_KDEL
ExpressionMammalianMutationFast mutation on SNAP-tag E30RPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_b4g-STf
Plasmid#182005PurposeCMV overexpression of SNAP-tag fast in the golgi apparatus of mammalian cell linesDepositorInsertb4g-STf
ExpressionMammalianMutationFast mutation on SNAP-tag E30RPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BLZinCh-P40
Plasmid#188057PurposeExpression of BLZinCh-P40, a dual read-out BRET-FRET sensor for intracellular Zn2+ imaging, in mammalian cellsDepositorInsertBLZinCh-P40
ExpressionMammalianPromoterCMV promotorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BLZinCh-P50
Plasmid#188058PurposeExpression of BLZinCh-P50, a dual read-out BRET-FRET sensor for intracellular Zn2+ imaging, in mammalian cellsDepositorInsertBLZinCh-P50
ExpressionMammalianPromoterCMV promotorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BLZinCh-P20
Plasmid#188055PurposeExpression of BLZinCh-P20, a dual read-out BRET-FRET sensor for intracellular Zn2+ imaging, in mammalian cellsDepositorInsertBLZinCh-P20
ExpressionMammalianPromoterCMV promotorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BLZinCh-P30
Plasmid#188056PurposeExpression of BLZinCh-P30, a dual read-out BRET-FRET sensor for intracellular Zn2+ imaging, in mammalian cellsDepositorInsertBLZinCh-P30
ExpressionMammalianPromoterCMV promotorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15 PemrR-gfp biosensor
Plasmid#185793PurposeThe pET15 PemrR-gfp biosensor is transcriptional fusion of GFP with the promoter of the emrRAB operon. This biosensor is responsive to monoaromatics, such as vanillin and syringaldehyde.DepositorInsertpEmrR-gfp
TagsEGFPExpressionBacterialPromoterPemrRAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-PGK-SNAP-MD-OCT4
Plasmid#115691PurposeConstitutive expression of an OCT4 (Pou5f1) protein tagged with SNAP-tag and a mitotic degron (MD)DepositorInsertSNAP-MD-OCT4
UseLentiviralAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only