We narrowed to 25,186 results for: Spr;
-
Plasmid#242537PurposeIVTDepositorInsertABEmax (NGG-ABE)
UseCRISPRMutationD10AAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEP0004_pIVTRup(BsmBI)_AncBE4max
Plasmid#242538PurposeIVTDepositorInsertAncBE4max (NGG-CBE)
UseCRISPRMutationD10AAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
cBEST3
Plasmid#234659PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and kasO17tssAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pADH99Cau
Plasmid#244807PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertCauHIS1_US
UseCRISPRTagsC. albicans MAL2 promoter, C. albicans codon opti…ExpressionYeastAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1017
Plasmid#239939PurposeCaMV 35S driving the expression of dCas9-ZAT10(1x)DepositorInsertCaMV 35S::dCas9-ZAT10(1x)
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1016
Plasmid#239938PurposeCaMV 35S driving the expression of dCas9-ZAT10(2x)DepositorInsertCaMV 35S::dCas9-ZAT10(2x)
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1023
Plasmid#239945PurposeCaMV 35S driving the expression of dCas9DepositorInsertCaMV 35S::dCas9
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1015
Plasmid#239937PurposeCaMV 35S driving the expression of dCas9DepositorInsertCaMV 35S::dCas9
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1019
Plasmid#239941PurposeCaMV 35S driving the expression of dCas9-ZAT10(1x)DepositorInsertCaMV 35S::dCas9-ZAT10(1x)
UseCRISPR and Synthetic BiologyExpressionPlantMutationN/AAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1018
Plasmid#239940PurposeCaMV 35S driving the expression of dCas9DepositorInsertCaMV 35S::dCas9
UseCRISPR and Synthetic BiologyExpressionPlantMutationN/AAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only