We narrowed to 10,674 results for: cat.1
-
Plasmid#66746Purposeluciferase reporter for Calb2 promoter (-264 to +80, WT)DepositorInsertCalb2 promoter (-264bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterCalb2Available sinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-419;+80pCalb2
Plasmid#66747Purposeluciferase reporter for Calb2 promoter (-419 to +80, WT)DepositorInsertCalb2 promoter (-419bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterCalb2Available sinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-NOS-IN133.3xFLAG.mCherry-WPRE
Plasmid#127868PurposepAAV plasmid expressing an NOS-IN133.3xFLAG.mCherry fusion protein under the hSyn promoterDepositorInsertNos1 (Nos1 Mouse)
UseAAVTags3xFLAG and mCherryExpressionMutationAmino acids 1-133 onlyPromoterhSynAvailable sinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-his-Gluc-iLID
Plasmid#172096PurposeExpresses a fusion protein of Gluc and iLID, which dimerizes with a sspB-tagged protein when the bioluminescent reaction is initiated, in bacteriaDepositorInsertGaussia Luciferase - iLID
UseTagsExpressionBacterialMutationGluc Mutations - M43L, M110LPromoterT7Available sinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
hHSF1 S303A
Plasmid#118363PurposeThis plasmid expresses human HSF1 S303A mutant, which cannot undergo sumoylation on K298 due to disrupted PDSM motif.DepositorInserthHSF1 (HSF1 Human)
UseTagsmyc and 6xHISExpressionMammalianMutationS303APromoterAvailable sinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Gluc-EL222-his
Plasmid#172097PurposeExpresses the fusion protein of Gluc and the light-activated transcription factor EL222 in bacteriaDepositorInsertGaussia Luciferase - EL222
UseTagsExpressionBacterialMutationGluc mutations - M43L, M110LPromoterT7Available sinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTriEx4-ADCY6-C1(306-672 aa)
Plasmid#113903PurposeHis-S tagged cytoplasmic catalytic domain 1 of Adenylate Cyclase 6DepositorInsertAdenylate Cyclase 6 cytoplasmic catalytic domain 1 (ADCY6 Human)
UseTagsHis-SExpressionBacterial, Insect, and Mamm…MutationPromoterT7, CMVAvailable sinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1281)
Plasmid#192955PurposeFor membrane insertion study; Expresses tse5-CT (1169-1281) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1281)
UseTagsExpressionBacterialMutationencodes for tse5 (1169-1281)PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-838;+80pCalb2
Plasmid#66750Purposeluciferase reporter for Calb2 promoter (-838 to +80, WT)DepositorInsertCalb2 promoter (-838bp +80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterCalb2Available sinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT21
Plasmid#78102Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
UseTagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 2…PromoterT7Available sinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT13
Plasmid#75087Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
UseTagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 4…PromoterAvailable sinceMay 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3m6L2
Plasmid#109366PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tagDepositorInsertUseTags1D4ExpressionMammalianMutationPromoterCMVAvailable sinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC8
Plasmid#224343PurposeExpresses human KDAC8 (HDAC8) in insect cellsDepositorInsertKDAC8 (HDAC8 Human)
UseTagsTEV-cleavable His6ExpressionInsectMutationPromoterPolyhedrinAvailable sinceFeb. 26, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSuper DGK zeta human
Plasmid#224575PurposeTo downregulate the expression of human DGK zeta in human cellsDepositorInsertsh RNAi Diacylglycerol kinase zeta human (DGKZ Human)
UseRNAiTagsExpressionMutationPromoterH1Available sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53(trunc C1)
Plasmid#221273PurposeExpression of IRSp53 C-terminal truncation 1 (247-355) in mammalian cells by retroviral transductionDepositorInsertIRSp53 C-terminal truncation 1 (247-355) (Baiap2 Mouse)
UseRetroviralTags3xFLAG-4xFKBPExpressionMutationPromoterAvailable sinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53(trunc N1)
Plasmid#221272PurposeExpression of IRSp53 N-terminal truncation 1 (257-375) in mammalian cells by retroviral transductionDepositorInsertIRSp53 N-terminal truncation 1 (257-375) (Baiap2 Mouse)
UseRetroviralTagsFLAG-4xFKBPExpressionMutationPromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-NIP45 delta-SLD2
Plasmid#210263PurposeInducible expression of N-terminally EGFP-tagged NIP45 delta-SLD2. Use with Flp-In T-Rex system.DepositorInsertNIP45 delta-SLD2 (aa 1-343) (NFATC2IP Synthetic)
UseTagsEGFPExpressionMammalianMutationdelta-SLD2PromoterCMV/TetO2Available sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1229)
Plasmid#192948PurposeFor membrane insertion study; expresses Tse5-CT (1169-1229)/PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1229)
UseTagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1229)PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1300)
Plasmid#192956PurposeFor membrane insertion study; Expresses tse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1300)
UseTagsExpressionBacterialMutationencodes for tse5 (1169-1300)PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only