We narrowed to 10,393 results for: EPO;
-
Plasmid#199733PurposeGolden Gate entry vector; 7th gRNA under OsU6.2 promoterDepositorInsertOsU6.2-sgRNA7 scaffold
ExpressionPlantAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBLsgRNA8
Plasmid#199734PurposeGolden Gate entry vector; 8th gRNA under TaU6 promoterDepositorInsertTaU6-sgRNA8 scaffold
ExpressionPlantAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPD554 ZF129x6-Compact_EYFP
Plasmid#138868PurposeEYFP reporter vector for the ZF129x6-Compact promoterDepositorInsertZF129x6-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF129x6-CompactAvailable SinceJan. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL0M-S-mClover3-EC18157
Plasmid#137076PurposeGolden Gate Level 0 S module for N-terminal fluorescent protein taggingDepositorInsertmClover3 DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
Myog'-2A-mCherryNLS-PGK-Puro
Plasmid#69548PurposeDonor vector for homologous recombination to insert a 2A-mCherry-NLS cassette in place of the stop codon of myogenin in the mouse genome.DepositorInsertsUseMouse TargetingTags2x nuclear localization signal and PVT1-2A "…MutationSilent V205V mutation in myogenin gene to prevent…Available SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRATIO1212
Plasmid#141299PurposeGateway cloning compatible dual fluorescent ratiometric binary vectorDepositorTypeEmpty backboneTagsmScarlet-I and mVenusExpressionPlantPromoterCaMV 35S promoterAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Golgi-DKAR
Plasmid#49790PurposeFRET-based, Golgi-targeted kinase activity reporter for PKDDepositorInsertD kinase activity reporter
TagsCFP, YFP, and eNOS(1-33)ExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLpC-L-IFP-F[1] (mammalian)
Plasmid#52901PurposeBinary retroviral pl. (puromycin). MCS:(GGGGS)X 2 + IFP-F[1] (ClaI/EcoRI). Insert can be subcloned between the MCS. Plasmid confers ampicillin resistance to DH5α.DepositorInsertL-IFP-F[1]
UseRetroviralExpressionMammalianPromoterUnknownAvailable SinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLpC-L-IFP-F[2] (mammalian)
Plasmid#52902PurposeBinary retroviral pl. (puromycin). MCS:(GGGGS)X 2 + IFP-F[2] (ClaI/EcoRI). Insert can be subcloned between the MCS. Plasmid confers ampicillin resistance to DH5α.DepositorInsertL-IFP-F[2]
UseRetroviralExpressionMammalianPromoterUnknownAvailable SinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only