We narrowed to 5,504 results for: crispr cas9 grna plasmid
-
Plasmid#223150PurposeExpression of truncated HP1a with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 72-177PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-PsppA-mCherry
Plasmid#225428PurposePlasmid encodes SgRNA, SpCas9 and homologous arms for homologous recombination of mCherryDepositorInsertmCherry, Cas9, SgRNA
UseCRISPRExpressionBacterialPromoterPsppA upstream of mCherry and Cas9, P3 upstream o…Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_AAN_4
Plasmid#231415PurposeThis AND-AND-NOT-gate plasmid expresses dCas9 from a constitutive promoter. Its sgRNAs X & Y are repressible by sgRNAs A & B, respectively. Its GFP gene is repressible by any of sgRNAs X, Y, and C.DepositorInsertsdCas9
GFP
sgRNA-X
sgRNA-Y
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
scAAV-sgRNA-GFP
Plasmid#177935PurposeExpresses sgRNA and can be packaged into AAV particles for somatic delivery into Cas9 transgenic miceDepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgHTT1-7sk-sgCas9
Plasmid#190900PurposeAAV-KamiCas9 vector expressing sgGFP and human HTT sgRNAsDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
Plasmid#117687PurposeU6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.DepositorInsertsKanamycin cassette
TetR-P2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and hPGKAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_2
Plasmid#155085Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_3
Plasmid#155089Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_3
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMD1_sgRNA_1
Plasmid#155091Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_3
Plasmid#155086Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_3
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_4
Plasmid#155087Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_4
Plasmid#155090Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
TU#1806_CRISPR_unc-73_exon21
Plasmid#82360Purposeto create unc-73E null alleleDepositorInsertCas9 and sgRNA against unc-73 exon21 (unc-73 Nematode)
UseCRISPRExpressionWormPromoterU6Available SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
TU#1805_CRISPR_unc-73_exon2
Plasmid#82359Purposeto create unc-73B null alleleDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF1_sgRNA
Plasmid#246403PurposeCas9/sgRNA expression plasmid targeting PHF1DepositorInsertPHF1 (PHF1 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgCnr1
Plasmid#209196PurposeMutagenesis of Cnr1DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
Plasmid#209199PurposeMutagenesis of Kcnma1DepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only