We narrowed to 5,521 results for: crispr cas9 grna plasmid
-
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_AAN_4
Plasmid#231415PurposeThis AND-AND-NOT-gate plasmid expresses dCas9 from a constitutive promoter. Its sgRNAs X & Y are repressible by sgRNAs A & B, respectively. Its GFP gene is repressible by any of sgRNAs X, Y, and C.DepositorInsertsdCas9
GFP
sgRNA-X
sgRNA-Y
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-PsppA-mCherry
Plasmid#225428PurposePlasmid encodes SgRNA, SpCas9 and homologous arms for homologous recombination of mCherryDepositorInsertmCherry, Cas9, SgRNA
UseCRISPRExpressionBacterialPromoterPsppA upstream of mCherry and Cas9, P3 upstream o…Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgHTT1-7sk-sgCas9
Plasmid#190900PurposeAAV-KamiCas9 vector expressing sgGFP and human HTT sgRNAsDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
scAAV-sgRNA-GFP
Plasmid#177935PurposeExpresses sgRNA and can be packaged into AAV particles for somatic delivery into Cas9 transgenic miceDepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
Plasmid#117687PurposeU6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.DepositorInsertsKanamycin cassette
TetR-P2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and hPGKAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_2
Plasmid#155085Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_3
Plasmid#155089Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_3
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_3
Plasmid#155086Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_3
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_4
Plasmid#155087Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_4
Plasmid#155090Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
TU#1806_CRISPR_unc-73_exon21
Plasmid#82360Purposeto create unc-73E null alleleDepositorInsertCas9 and sgRNA against unc-73 exon21 (unc-73 Nematode)
UseCRISPRExpressionWormPromoterU6Available SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only