We narrowed to 15,372 results for: sgRNA
-
Plasmid#162996Purposeplasmid expressing an sgRNA targeting the BEAR-mScarlet plasmid along with a TagBFP markerDepositorInsertsgRNA targeting the BEAR-mScarlet plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL11057
Plasmid#68253PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting PM19_1 in barleyDepositorInsertPromote:TaU6+sgRNA HvPM19_1
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC548
Plasmid#62316PurposesgRNA with 1x PP7 for yeast cellsDepositorInsertsgRNA + 1x PP7
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-eSpCas9
Plasmid#126769PurposeExpression of increased fidelity eSpCas9 in bacterial cellsDepositorInserteSpCas9
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationK848A, K1003A, R1060APromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX-APRT-sg2
Plasmid#107274PurposeAPRT sgRNA-2 and Cas9 expression vectorDepositorInsertAPRT sgRNA-2
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC35
Plasmid#62325PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC102
Plasmid#62337PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK_1
Plasmid#163462Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADKDepositorInsertsgRNA 1 targeting NADK (NADK Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKH-1699
Plasmid#124227PurposeMammalian SpCas9-HF1 expressionDepositorInsertSpCas9-HF1
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(G:H)
Plasmid#138257PurposeExpression of GFP-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequence to be used in yeast dual reporter systemDepositorInsertGFP targeting sgRNAs G and H
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(G:H)
Plasmid#138259PurposeExpression of humanized mCherry-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequences to be used in Traffic Light reporter systemDepositorInsertmCherry targeting sgRNAs G and H
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-SENP8 sg2R-P2A-Hygro
Plasmid#124300PurposeLentiviral vector for expression of Flag tagged SENP8-P2A-Hygro casette from a CMV promoter. SENP8 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertSENP8 (SENP8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targetiā¦PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-2
Plasmid#86135PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorInsertsgRNA targeting C17orf89 (NDUFAF8 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-3
Plasmid#86136PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-1
Plasmid#86137PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC103
Plasmid#62340PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo
Plasmid#139449PurposeLentiviral vector with gRNA scaffold and neomycin selectable markerDepositorInsertno sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only