We narrowed to 8,953 results for: aav
-
Plasmid#216276PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of red fluorescent calcium indicator jRGECO1aDepositorInsertNES-jRGECO1a
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman synapsin 1 (hSyn)Available sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE
Plasmid#141236PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of jRGECO1a (jRGECO1a will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertNES-jRGECO1a
UseAAV and Cre/Lox; Cre-offTags6xHIS tag and nuclear export signalPromoterhuman elongation factor-1 alpha (EF-1 alpha)Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-mRuby3-2A-Cre
Plasmid#203844PurposeFlp-dependent Cre and mRuby3 expressionDepositorInsertCre
UseAAVTagsmRuby3-2AAvailable sinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-DIO-ChroME2f-ST-P2A-H2B-mRuby3
Plasmid#171150PurposeCation channelrhodopsin ChroME2f targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorInsertChroME2f-P2A-H2B-mRuby3
UseAAVExpressionMammalianAvailable sinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-DIO-TRPV4-p2A-ferritin-sNRPpA
Plasmid#74306PurposeBicistronic Cre-dependent expression of TRPV4 & ferritin in mammalian cellsDepositorUseAAV and Cre/LoxTagsFLAG and p2AExpressionMammalianPromoterCMV (after cre recombination)Available sinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-linker-TlcnC
Plasmid#114377Purposeexpresses Flpo recombinase-dependent GtACR2-Kv2.1C-linker-TlcnC, which targets GtACR2 to the somatodendritic compartment. Messier et al found this hybrid construct was the most effective at targetingDepositorInsertGtACR2-EYFP-Kv2.1C-linker-TlcnC (NEWENTRY )
UseAAVTagsEYFP and Kv2.1C-linker-TlcnCExpressionMammalianPromoterEf1aAvailable sinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-eGFP
Plasmid#247941PurposeAAV transfer plasmid encoding enhanced Green Fluoresence Protein control of the CMVie enhanced synapsin1 promoterDepositorInserteGFP
UseAAVPromoterCMVenh synapsinAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G12-AkaLuc-P2A-Proinsulin
Plasmid#241776PurposeTested on HeLa for bioluminescence, and used for production of AAV G12-Akaluc-P2A-Proinsulin for mice.DepositorInsertAkaLuc-P2A-Proinsulin
UseAAVPromoter12xUAS with TATA-box minimal promoterAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-EcYtR(NGS-6)-mCherry
Plasmid#217363PurposeExpresses E. coli tyrosine tRNA variant "NGS-6" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli tyrosine tRNA mutant, "NGS-6"
UseAAVExpressionMammalianPromoterU6Available sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS2604_AAV-Nme2-ABE8e-i1(V106W)-U6-Rosa26
Plasmid#201686PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1 (V106W) and U6 driven sgRNA targeting the mouse Rosa26 geneDepositorInsertNme2-ABE8e-i1 (V106W)
UseAAV and CRISPRExpressionMammalianPromoterU1aAvailable sinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLEX-rc [SomArchon-GFP]
Plasmid#153532PurposeAAV-mediated expression of SomArchon-GFP under the EF1α1.1 promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertSomArchon-GFP
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α1.1Available sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
PP_072_pAAV_hSyn_DIO-LR-Voltron2-P2A-LR-CheRiff-HA
Plasmid#230988PurposeCo-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertCre-dependent, membrane-localized optopatch for neuronal dendrites
UseAAVExpressionMammalianPromoterhSynAvailable sinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria3
Plasmid#124855PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a6
Plasmid#124860PurposeMutagenesis of Slc17a6DepositorInsertSlc17a6 (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a8
Plasmid#124861PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Ace-mNeon2
Plasmid#195526PurposeGreen fluorescent, negative response-polarity voltage indicator under the control of CaMKII promoterDepositorInsertAce-mNeon2
UseAAVExpressionMammalianMutationAce-mNeon 81S; SY linkerPromoterCaMKIIAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-Syn-VARNAM2-Kv2.1PR
Plasmid#195524PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targetedDepositorInsertVARNAM2-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationVARNAM SI linkerPromoterSynapsinAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-pAceR-Kv2.1PR
Plasmid#195525PurposeRed fluorescent, positive response-polarity voltage indicator under the control of synapsin promoter; soma-targetedDepositorInsertpAceR-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationVARNAM 78E, 81D, 92N; SI linkerPromoterSynapsinAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CMV-GFP-BGHpA
Plasmid#190239PurposeExpresses EGFP in mammalian cellsDepositorInsertEGFP
UseAAVExpressionMammalianAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only