We narrowed to 5,089 results for: NAP
-
Plasmid#138517PurposeP3aDepositorInsertT7-RNAP
UseSynthetic BiologyAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
GOSR2(G144W)-mCherry
Plasmid#209887PurposeExpresses human GOSR2 (GS27) G144W-mutant fused to mChery in mammalian cellsDepositorInsertGOSR2 (GOSR2 Human)
TagsmCherryExpressionMammalianMutationChanged glycine 144 to tryptophan; this mutation …PromoterCMVAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-NLS-SaCas9-NLS-3xHA-bGHpA-U6-BsaI-sgRNA
Plasmid#218710PurposeAAV vector plasmid expressing Cas9 from Staphylococcus aureus (SaCas9) under the human synapsin (SYN) promoter and its sgRNA under the U6 promoterDepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
CP2-TCC
Plasmid#179679PurposeComplementary plasmidDepositorInsert[sd2] T7 RNAP-TCC linker-degron
ExpressionBacterialAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
IDP432
Plasmid#87000Purposeplasmid for cell culture expression of SYNseq componentsDepositorInsertSNAP-Nlg1AB-1xλN(i)
UseSynthetic BiologyExpressionMammalianPromoterEF1aAvailable SinceFeb. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBRα
Plasmid#53731PurposePlpp/PlacUV5 -directed synthesis of E. coli RNAP alpha subunit; used as two-hybrid control. For cloning purposes, see Addgene plasmid 53734.DepositorInsertαNTD
ExpressionBacterialPromoterlpp/lacUV5 (tandem promoter)Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-flex-oChIEF-citrine
Plasmid#50973Purposeflexed oChIEF-citrine construct in an AAV transfer vector containing AAV2 ITRDepositorInsertChIEF-citrine
UseAAVTagscitrineMutationinverted and inserted between two lox sitesPromoterhuman synapsin promoterAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDM_T7_HisLacZomega
Plasmid#118815PurposeT7 RNAP-driven expression of N-terminal His-tagged lacZ omega subunit.DepositorInsertlacZ_
TagshistagExpressionBacterialAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Crimson/P2A-ICP8 (pSLIK1)
Plasmid#113856PurposeFor Doxycycline-inducible expression of ICP8 synaptase, with red fluorescent protein gene E2-Crimson-P2A-ICP8DepositorInsertICP8
UseLentiviralTagsP2A/CrimsonAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GluA2-scFv-mNeon-KDEL
Plasmid#230057PurposeAAV plasmid that expresses a a single chain variable fragment (scFv) for anti- GluA2 with a C-terminal mNeon. Encodes an ER retrieval motif (KDEL) at C-terminus of mNeon.DepositorInsertAnti-GluA2 single chain variable fragment (scFv)
UseAAVTagsER retrieval motif (KDEL) and mNeonExpressionMammalianPromoterhuman synapsinAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBT138b-proB
Plasmid#138515PurposeP3fDepositorInsertT7-RNAP
UseSynthetic BiologyAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMR-A-5
Plasmid#138519PurposeP3cDepositorInsertT7-RNAP
UseSynthetic BiologyAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDB007ns2a
Plasmid#99214PurposeAccessory plasmid for PACE of PylRS variants; negative selectionDepositorInsertPpsp [SD8] gIII; PproK tyrT(Opt,CUA); Ptet [SD4] T7RNAP(S12*,S203*)
Mutationamber codons at positions 12 and 203 of T7 RNA po…PromoterPpsp, PproK, and PtetAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
ICP8-P2A/Crimson (pSLIK4)
Plasmid#113859PurposeFor Doxycycline-inducible expression of ICP8 synaptase gene, with ICP8-P2A-red fluorescent protein gene E2-CrimsonDepositorInsertICP8
UseLentiviralTagsP2A/CrimsonAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GluA1-scFv-mNeon-KDEL
Plasmid#230056PurposeAAV plasmid that expresses a single chain variable fragment (scFv) for anti-GluA1 tagged with mNeon. Encodes an ER retrieval motif (KDEL) at C-terminus of mNeon.DepositorInsertAnti-GluA1 single chain variable fragment (scFv)
UseAAVTagsER retrieval motif (KDEL) and mNeonExpressionMammalianPromoterhuman synapsinAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-DiO-eGFP-2A-mCherry_D4H
Plasmid#194880PurposeRatiometric D4H sensor for in vivo cre-dependent neuron-specific cholesterol visualizationDepositorInsertGFP-T2A-mCherry-D4H
UseAAV and Cre/LoxExpressionMammalianPromoterhuman SynapsinAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GluA1-scFv-Halo
Plasmid#230055PurposeAAV plasmid that expresses a single chain variable fragment (scFv) for anti-GluA1 fused to halotag. Can be directly transfected into neurons or used to prepare AAV expressing GluA1-scFv-Halo.DepositorInsertAnti-GluA1 single chain variable fragment (scFv)
UseAAVTagsHaloTagExpressionMammalianPromoterhuman synapsinAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMR-A-6
Plasmid#138520PurposeP3dDepositorInsertT7-RNAP
UseSynthetic BiologyAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only