We narrowed to 15,421 results for: sgRNA
-
Plasmid#178091PurposeExpresses the NPM1 G6 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with NPM1_mNeonGreen_Donor to tag NPM1 with mNeonGreen. pX330-like plasmid.DepositorInsertNPM1 G6 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-GOLGA2
Plasmid#207791PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of GOLGA2 for knock-in.DepositorInsertsgRNA Targeting N-terminus of GOLGA2 (GOLGA2 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-CANX
Plasmid#227279PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of CANX for knock-in.DepositorAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TOMM20
Plasmid#207789PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TOMM20 for knock-in.DepositorInsertsgRNA Targeting C-terminus of TOMM20 (TOMM20 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-VIM
Plasmid#227301PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of VIM for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-MAPRE1
Plasmid#207793PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of MAPRE1 for knock-in.DepositorInsertsgRNA Targeting C-terminus of MAPRE1 (MAPRE1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-CEP135
Plasmid#227286PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CEP135 for knock-in.DepositorInsertsgRNA Targeting N-terminus of CEP135 (CEP135 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-AncBE4max
Plasmid#174164PurposeThis is an AncBE4max (a cytosine base editor) expressing plasmid built on the 3rd generation system of lentiviral vector. It can be used for stable expression of AncBE4max in cells.DepositorInsertAncBE4max
UseLentiviralTagsP2A-mCherryAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B5
Plasmid#172846PurposeCRISPIE donor B5 (Zhong et al, eLife 2021), CDS of VCL exon21-mEGFP, translational phase (0-stop), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-stop) encoding the CDS of VCL exon 21 fused to mEGFP
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9-pAc
Plasmid#162163PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectableDepositorInsertshSpCas9
sgRNA
UseCRISPRTagsT2A-pAcExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cre stuffer v4
Plasmid#158033PurposeLentiviral construct with Cas9, Cre recombinase and U6 driven sgRNA cassette with modified tracr RNA (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSP1673
Plasmid#65769PurposeBacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNADepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA
UseCRISPRTagsNLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.tRFP
Plasmid#57826PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-tRFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_1
Plasmid#138324PurposeExpress guide RNA 2 for mouse MycDepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-pegSERPINA1-U6-Nicking-PE2-N
Plasmid#164907PurposeExpress a pegRNA targeting SERPINA1, and a nicking sgRNA and the N-terminal split-intein fragment of PE2DepositorInsertpegSERPINA1, Nicking sgRNA, PE2-N
UseAAVAvailable SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_2
Plasmid#138346PurposeExpress guide RNA 1 for mouse MycDepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-PermE
Plasmid#209446Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning siteDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from ermE* promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only