We narrowed to 3,364 results for: guide rna expression plasmid

#98134

Expresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 system

Hodaka Fujii

Fujita et al BMC Res Notes. 2018 Feb 27;11(1):154. do

March 16, 2018

Academic Institutions and Nonprofits only

#105283

Expresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 system

Hodaka Fujii

Fujita et al BMC Res Notes. 2018 Feb 27;11(1):154. do

March 16, 2018

Academic Institutions and Nonprofits only

#207355

Lentiviral transfer plasmid encoding hU6-driven expression of a RNF2 engineered prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.

Marianne Carlon

Bulcaen et al Cell Rep Med. 2024 May 21;5(5):101544. d

April 19, 2024

Academic Institutions and Nonprofits only

#60228

Expresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA control targeting LacZ. AAV backbone.

Feng Zhang

Platt et al Cell. 2014 Sep 24. pii: S0092-8674(14)01

Nov. 3, 2014

Academic Institutions and Nonprofits only

#60227

Expresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA targeting the mouse gene NeuN. AAV backbone.

Feng Zhang

Platt et al Cell. 2014 Sep 24. pii: S0092-8674(14)01

Nov. 3, 2014

Academic Institutions and Nonprofits only

#207878

AAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).

Yeh-Hsing Lao

Lao et al Proc Natl Acad Sci U S A. 2023 Aug 22;12

Oct. 13, 2023

Academic Institutions and Nonprofits only

#207880

AAV vector encoding EF1a core promoter-driven SaCas9 and single sgRNA cloning site w/ the engineered Sa Guide scaffold variant (BbsI for sgRNA cloning).

Yeh-Hsing Lao

Lao et al Proc Natl Acad Sci U S A. 2023 Aug 22;12

Nov. 16, 2023

Academic Institutions and Nonprofits only

#246432

All-in-one plasmid. Expresses R-IscB_ADAR2dd in mammalian cells for A-to-I RNA editing. Inactive mCherry included to assess A-to-I editing. Spacer included can direct mCherry fluorescence recovery.

Ailong Ke

Xu et al Cell. 2025 Aug 18:S0092-8674(25)00854-2.

Nov. 13, 2025

Academic Institutions and Nonprofits only

#154839

Cas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGG

Patrick Phillips

Stevenson et al G3 (Bethesda). 2020 Aug 19. pii: g3.120.

Aug. 6, 2020

Academic Institutions and Nonprofits only

#135339

Expression plasmid of VP64-SadCas9 sgRNA 1, 2 and 3

Ronald Cohn

Kemaladewi et al Nature. 2019 Aug;572(7767):125-130. doi:

March 11, 2020

Academic Institutions and Nonprofits only