We narrowed to 11,287 results for: aga
-
Plasmid#113968PurposeSingle short guide RNA targeting CAATGTATCTTATCATGTCDepositorInsertsg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-FOXA1
Plasmid#139304PurposeKnocking down of human FOXA1 through shRNA and amiRNA targeting FOXA1DepositorInsertshRNA and amiRNA against FOXA1
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(G:H)
Plasmid#138257PurposeExpression of GFP-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequence to be used in yeast dual reporter systemDepositorInsertGFP targeting sgRNAs G and H
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(G:H)
Plasmid#138259PurposeExpression of humanized mCherry-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequences to be used in Traffic Light reporter systemDepositorInsertmCherry targeting sgRNAs G and H
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFR093
Plasmid#134149PurposeExpression of CENP-TDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-4xUAS
Plasmid#125149PurposeVector to measure the activity of CP candidates in response to a tethered (4xUAS) GAL4-DBD-COF by determining the abundance of transcripts originating from each candidate in fly cellsDepositorInsert4 x upstream activating sequence (UAS)
UseStap-seq screening vectorAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG_P-HXT1-FAS1up
Plasmid#126747Purposevector for replacing the promoter of FAS1 coding geneDepositorInsertfas1 upstream
Tags6xHisExpressionYeastPromoterHXT1Available SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZ_P-HXT1-FAS1up
Plasmid#126746Purposevector for replacing the promoter of FAS1 coding geneDepositorInsertfas1 upstream
Tags6xHisExpressionYeastPromoterHXT1Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Trf2
Plasmid#125159PurposeGateway entry cloneDepositorInsertTrf2 (Trf2 Fly)
UseGateway entry vectorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
gamma2 UTR shRNA (shRNA4)
Plasmid#120796PurposeshRNA targeting the 3'-untranslated region (UTR) of the gamma2 mRNADepositorInsertGABRG2 shRNA (Gabrg2 Rat)
UseRNAiAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pGEX-4T1-MYB-TAD(251-327)
Plasmid#105619Purposebacterially express GST tagged MYB TADDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G10-R20
Plasmid#101819PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-N3FLAG-TAF12-HFD(50-130)
Plasmid#105615Purposetransient express TAF12 HFD with 3*FLAG tag at N terminal in HEK 293T cellsDepositorInsertTAF12-HFD amino acid 50-130 with FLAG tag (Taf12 Mouse)
Tags3*FLAGExpressionMammalianPromoterCMVAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-TADA1-HFD(140-230)
Plasmid#105984Purposetransient express TADA1-HFD fragment in HEK 293T cellsDepositorAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC27
Plasmid#104801PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g020620 (Pho2ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g020620
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1 mSesn2 (1190)
Plasmid#66916Purposebacterial expression of mouse Sesn2DepositorAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G14-R20
Plasmid#101821PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G11-R20
Plasmid#101820PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only