We narrowed to 14,372 results for: Cas9
-
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
JME4472
Plasmid#129658PurposeURA3ex_CrisprCas9-yl_RFP: CAS9 vector with URA3ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRGEB33
Plasmid#158151PurposeConstruction of inPTG-Cas9 plasmids expressing gRNA within an engineered intron for binary vector plant genome editing.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYZ033
Plasmid#98404PurposeEntry vector for S. pombe CRISPR-Cas9 system. The gRNA can be integrated easily through Gibson Assembly with the plasmid backbone digested by Not1DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ173
Plasmid#98410PurposeCas9-gRNA lys9 plasmid for lys9 deletion in S. pombeDepositorInsertgRNA targeting Sp.lys9 (SPBC3B8.03 Fission Yeast)
UseCRISPRAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBLO1808_arC9_2xNLS_human
Plasmid#74491PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/2xNLS and a sgRNADepositorInsertarC9
Tagst2a mCherryExpressionMammalianAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pAEF5
Plasmid#136305PurposePlasmid encoding the Cas9 gene and a gRNA expression cassette allowing to clone a single or multiple gRNAs for DSBs induction in yeast. Constructed by Aubin FleissDepositorTypeEmpty backboneUseCRISPRAvailable SinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJAT57
Plasmid#204303PurposeExpresses Cas9 under UAS control. HDR integrant markers with DsRed expressed in flight muscles.DepositorInsertMHC-DsRed
UseCRISPRPromoterMHCAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRGEB34
Plasmid#158152PurposeConstruction of inPTG-Cas9 plasmids with a truncated 5'-UTR intron for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP nLAP +0
Plasmid#194305PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
JME4393
Plasmid#129657PurposeLYS5ex_CrisprCas9-yl_RFP: CAS9 vector with LYS5ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLdSaCN
Plasmid#123261PurposeExpresses Staphylococcus aureus Cas9 (SaCas9) and its gRNA in LeishmaniaDepositorInsertgRNA and SaCas9
UseCRISPR; LeishmaniaAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBC2102-reci
Plasmid#117171PurposeU6-sgRNA-EFS-Cas9-T2A-mCherry-P2A-Hygro; wtCas9 without NLSDepositorInsertreci_wtCas9 without NLS
UseLentiviralPromoterU6 PromoterAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-TREX2-N
Plasmid#244022PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-AtEXO1B-N
Plasmid#244023PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCPH3.3-GS3
Plasmid#204764PurposeExpression of Cas9 and human H3.3DepositorInsertH3.3
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only