We narrowed to 171,099 results for: addgene
-
Plasmid#232971PurposeGalactose iduced expression of Gcn4 Proline in yeastDepositorInsertGcn4 Proline
TagsTEV cleavage siteExpressionYeastMutationS122P, T131F, A141P, E143DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 9acidAHA
Plasmid#232997PurposeGalactose iduced expression of Gcn4 9acidAHA in yeastDepositorInsertGcn4 9acidA
Tags3xHA and TEV cleavage siteExpressionYeastMutationE109A, E111A, E114A, D115A, E119A, D125A, D127A, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 9acidA
Plasmid#232967PurposeGalactose iduced expression of Gcn4 9acidA in yeastDepositorInsertGcn4 9acidA
TagsTEV cleavage siteExpressionYeastMutationE109A, E111A, E114A, D115A, E119A, D125A, D127A, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 E2K2
Plasmid#232968PurposeGalactose iduced expression of Gcn4 EK+ in yeastDepositorInsertGcn4 EK+
TagsTEV cleavage siteExpressionYeastMutationS104K, S117E, S136E, S144KPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
ppAG415Gal_Gcn4 L113A+
Plasmid#232972PurposeGalactose iduced expression of Gcn4 L113A in yeastDepositorInsertGcn4 L113A
TagsTEV cleavage siteExpressionYeastMutationL113A, E114Y, N126H, D127E, S136APromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Aro3+GFP
Plasmid#233002PurposeGalactose iduced expression of Gcn4 Aro3+GFP in yeastDepositorInsertGcn4 Aro3+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationD103Y, N112T, L113Y, S117F, K140RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED
Plasmid#232957PurposeGalactose iduced expression of Gcn4 ILVtoED in yeastDepositorInsertGcn4 ILVtoED
TagsTEV cleavage siteExpressionYeastMutationL123D, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 StoL
Plasmid#232981PurposeGalactose iduced expression of Gcn4 StoL in yeastDepositorInsertGcn4 StoL
TagsTEV cleavage siteExpressionYeastMutationS104L, S117L, S136L, S144LPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 R3W
Plasmid#232975PurposeGalactose iduced expression of Gcn4 R++ W+ in yeastDepositorInsertGcn4 R++ W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationD103R, N126W, D133R, K143RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44mer
Plasmid#232956PurposeGalactose iduced expression of Gcn4 WT 44mer in yeastDepositorInsertGcn4 WT 44mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 E3HA
Plasmid#232996PurposeGalactose iduced expression of Gcn4 E+HA in yeastDepositorInsertGcn4 E+
Tags3xHA and TEV cleavage siteExpressionYeastMutationD105E, D118E, D139EPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WW+
Plasmid#232984PurposeGalactose iduced expression of Gcn4 WW+ in yeastDepositorInsertGcn4 WW+
TagsTEV cleavage siteExpressionYeastMutationE109N, S117D, T121W, N126W, T132WPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoAS
Plasmid#232959PurposeGalactose iduced expression of Gcn4 ILVtoAS in yeastDepositorInsertGcn4 ILVtoAS
TagsTEV cleavage siteExpressionYeastMutationL123S, I128S, V130A, V135A, L137S, I142SPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44merGFP
Plasmid#233000PurposeGalactose iduced expression of Gcn4 WT 44merGFP in yeastDepositorInsertGcn4 WT 44mer
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 30mer
Plasmid#232986PurposeGalactose iduced expression of Gcn4 WT 30mer in yeastDepositorInsertGcn4 WT 30mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1133
Plasmid#229869PurposeDestination RMCE vector containing FRT::SA::51-bp Artificial exon::3xStop::SL2::SapI Insertion sites (to clone new driver with 3'UTR in slot 5 and SEC in slot 6)::reverse FRT3 to swap driver via RMCEDepositorTypeEmpty backboneExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Halo XRCC4
Plasmid#207541PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous XRCC4 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human XRCC4 locus sequences
TagsHaloTagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only