We narrowed to 41,229 results for: kan
-
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits
-
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKS100
Plasmid#24630DepositorInsertfadD
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 11, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJMP3653
Plasmid#222348PurposeExpression vector with PabstBR promoter, kanR marker, and replicates in A. baumannii and E. coli; empty vector plasmid with MCS for cloning - we recommend NcoI/BamHI.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH-roGFP2-synORP1
Plasmid#191680PurposeTi plasmid pICH86988 harbouring roGFP2-synORP1 for H2O2 detection in plant cells.DepositorInsertrredox(roGFP2-synORP1
ExpressionPlantPromoterCaMV 35SAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_12 [pAMβ1 ORI]
Plasmid#198926PurposeLevel 0 partDepositorInsertpAMβ1 ORI
UseSynthetic BiologyAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
p52sheLL
Plasmid#46950PurposeHPV52 L1 and L2 Bicistronic, too large to self-packageDepositorAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSAM_Cam
Plasmid#91570PurposeMariner transposon mutagenesis & sequencing vector - Transposon contains KanR and Illumina sequencing adapters. Lac promoter expresses transposase. Chloramphenicol resistance on backbone.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-GFP1-10-IRES-Puro
Plasmid#211467PurposeLentivirus backbone expressing GFP1-10DepositorInsertGFP1-10
UseLentiviralExpressionMammalianPromoterEF-1aAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXLK_aFb
Plasmid#114230PurposePOC12368, MetClo assembly vector with p15A replication origin and kanamycin resistance for BsaI-based MetClo, adaptor sequence type a-bDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP3654
Plasmid#222349PurposeExpression vector with GFP expressed under PabstBR promoter, kanR marker, and replicates in A. baumannii and E. coli.DepositorInsertsfGFP
ExpressionBacterialPromoterPabstBRAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDB4581
Plasmid#171124PurposeA kanMX-marked pFA6a based plasmid, which has a 7-aa linker, a 16-aa XTEN16 linker, three tandam repeats of sAID. It serves as the template for 3_sAID degron tagging at the C-terminus.DepositorInsert3_sAID
UseOtherMutationnon applicableAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDD120
Plasmid#119879PurposeConstitutive expression of Che9c60 and Che9c61 recombinases on pB264/pBR322 backbone with kanamycin resistance.DepositorInsertpConstitutive_Che9c60 and Che9c61
ExpressionBacterialAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
mRuby-PH-PLCdelta
Plasmid#162440Purposefor use in CIT (chemically induced trimerization) systemDepositorInsertmRuby-PH-PLCdelta
ExpressionMammalianPromoterCMVAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL0_1 [RK2 ORI]
Plasmid#198918PurposeLevel 0 partDepositorInsertRK2 ORI
UseSynthetic BiologyAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDD57
Plasmid#119882PurposeConstitutive expression of GFP+ on pAL5000/pMB1 backbone with kanamycin resistance.DepositorInsertpConstitutive_GFP+
ExpressionBacterialAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
B-gTEMP/pRSET-b
Plasmid#188446PurposeB-gTEMP for bacterial expressionDepositorInsertB-gTEMP
Tags6xHis-tagExpressionBacterialAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-Vx3K0-mEGFP
Plasmid#35527DepositorInsertVx3K0
UseRetroviralTagsmEGFPExpressionMammalianPromoterCMVAvailable SinceApril 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFS554
Plasmid#242854PurposeThis plasmid will be used to replace the promoter of a gene with the PenotetSW3 promoter at its endogenous locusDepositorInsertsTetR
mECitrine
ExpressionYeastPromoterCMV promoter and enotetSW3 promoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFS553
Plasmid#242853PurposeThis plasmid will be used to replace the promoter of a gene with the PenotetSW2 promoter at its endogenous locusDepositorInsertsTetR
mECitrine
ExpressionYeastPromoterCMV promoter and enotetSW2 promoterAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only