We narrowed to 7,585 results for: mCherry
-
Plasmid#86745PurposeN-terminal mCherry-tagged protein expression in mammalian cellsDepositorAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL403
Plasmid#243721PurposeStably expresses a chimeric reporter with a mCherry (1-105aa)-XTEN250 linker-TBRG4(351aa-631aa), flanked by 5' and 3'UTRs of ALDH18A1 and no mitochondrial targeting sequenceDepositorInsertmCherry(1-105aa)-XTEN250-TBRG4(351aa-631aa), flanked by 5' and 3'UTRs of ALDH18A1 and no mitochondrial targeting sequence
UseLentiviralAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
LpABCB1-NmCherry
Plasmid#232276PurposeVector for overexpression of Lytechinus pictus ABCB1 with an N terminal mCherry tagDepositorInsertABCB1
UseSynthetic BiologyTagsmCherryPromoterSP6Available sinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT6-V5H6.MCh.Puro
Plasmid#209944PurposeIn mammalian cells expresses TP fused to a CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 6 (CNOT6 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-2xFLAG-2xSTREP-CCND2-IRES-mCherry
Plasmid#172627PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D2 and mCherry in mammalian cellsDepositorAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mCherry-C1-ORP5-H478-9A-deltaTMD-FKBP
Plasmid#220075Purposeexpresses a mutant ORP5 that is unable to bind to PI4P with an mCherry fluorophore and an FKBPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertOSBPL5 H478/9A (OSBPL5 Human)
ExpressionMammalianMutationH478/9A, deltaTMDAvailable sinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMN-285
Plasmid#195472PurposeLentiviral Integratable Inducible CD19CAR using synZiFTR ZF10DepositorInsert8X ZF10 BS - ybTATA - CD19 CAR - mCherry
UseLentiviralExpressionMammalianAvailable sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-POLD1
Plasmid#215139PurposeExpresses mCherry-POLD1 in mammalian cells from a retroviral vector.DepositorAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1-cofilin
Plasmid#186750PurposeExpresses wildtype mCherry-tagged human cofilin in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCofilin-1 (CFL1 Human)
TagsmCherryExpressionMammalianPromoterCMVAvailable sinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 947 (pME-mmTcf4_DN_P2A_mCherry)
Plasmid#232122PurposeA middle entry gateway clone containing myc-tagged murine dominant negative Tcf4 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorPublicationAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1-GW yomCherry-T2A-mTurquoise2
Plasmid#118447PurposeProduces equimolar expression of yeast codon-optimized mCherry and mTq2DepositorInsertyomCherry-T2A-mTurquoise2
ExpressionYeastAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA-SV40-mCherry
Plasmid#240538PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with mCherry. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-Hyg-Dest-mCherry-PAR-6B
Plasmid#194908PurposeTo generate mCherry-PAR-6B (mouse) expressing stable cell lines with piggybac transposase co-expression and hygromycin selections.DepositorInsertPAR-6B (Pard6b Mouse)
UseMouse TargetingTagsmCherryExpressionMammalianMutation39 C to G, silent mutationAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLEX-NEUROD1-T2A-mCherry
Plasmid#178584PurposeCre-dependent expression of NEUROD1 and mCherry under the constitutive promoterDepositorAvailable sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-mCherry-p2A-LIC1 C-terminal half
Plasmid#74603Purposeexpresses LIC1 in mammalian cells; aa 389-523, untagged but cells indicate expression with diffuse mCherryDepositorInsertfull length human dynein light intermediate chain 1 amino acids 389-523 (DYNC1LI1 Human)
UseLentiviralTagsHA tagExpressionMammalianMutationamino acids 389-523 of LIC1PromoterSFFVAvailable sinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
P-Ef1a-RPL22-3XHA-P2A-mCherry-T2A-Neo
Plasmid#170321PurposeExpresses HA and mCherry tagged RPL22, neomycin resistanceDepositorAvailable sinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
(pRZ115) AAV: U6-gRNA-EF1a-mCherry
Plasmid#254584PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pN1-mCherry-NKD2
Plasmid#176641PurposeExpresses NKD2-mCherry fusion protein in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHomo sapiens NKD inhibitor of WNT signaling pathway 2 (NKD2 Human)
TagsmCherry tagExpressionMammalianPromoterCMVAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only