We narrowed to 17,203 results for: CAN
-
Plasmid#84565PurposeThis plasmid can be used as a donor for subcloning into Gateway destination vectors.DepositorAvailable SinceOct. 19, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pANC98c(3xFLAG-NES-FRB-(G4S)4-cTEV(219)-IRES-EBFP)
Plasmid#248359PurposeLentiviral vector that can express FRB along with a truncated C terminal split TEV. Expressed off of CMV tet ON promoter with EBFP markerDepositorInsert3xFLAG-NES-FRB-(G4S)4x-cTEV(219)
UseLentiviralPromotertight TREAvailable SinceJan. 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
JARID1D-HE-AA
Plasmid#242617PurposeExpresses catalytic mutant JARID1DDepositorAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pQβEP1
Plasmid#210859PurposeExpress phage Qβ with SARS-CoV Spike protein epitope 1 displayed on the surface that can bind anti-S antibodies under T7 promotorDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pQβEP3
Plasmid#210861PurposeExpress phage Qβ with SARS-CoV Spike protein epitope 3 displayed on the surface that can bind anti-S antibodies under T7 promotorDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
huCofilin S3E SSR
Plasmid#245940PurposeExpresses human cofilin with mutation S3E that behaves like inactive phosphocofilin but can be dominant negative against phosphataseDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationS3E; silent mutations (NTs 67 to 75) in which TCT…PromoterCMVAvailable SinceOct. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCas3-APOBEC1
Plasmid#229536PurposepMV_hyg encoding Cas3(wt)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
Cas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-6
Plasmid#227669PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. GmR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
ExpressionBacterialPromoterPEM7Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-CDA1
Plasmid#229534PurposepMV_hyg encoding Cas3(wt)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsCas3
Cytidine deaminase
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only