We narrowed to 30,307 results for: ple
-
Plasmid#106015PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR32; Opto-GPR32; B5)DepositorInsertOpto-GPR32 (GPR32 Human, Bovine)
TagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-biotin-myc- mCE
Plasmid#82475PurposeExpresses mRNA capping enzyme containing N terminal biotin and myc tagDepositorAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMflCT-o4
Plasmid#101313PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and cat resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
cat resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p.UTA.2.0-GL-2-3 perfect copies
Plasmid#82441PurposeDual Fluorescent endogenous miRNA sensor Control insert. Three Perfect copies of complementary region of a siRNA control targeting firefly luciferase encoded by the pGL2DepositorInsertLuciferase
MutationThe complementary region for GL2 siRNA control wa…Available SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVH003
Plasmid#80397PurposeContains pBAD-CusR (response regulator) and pCusR-antiscaffold-YFP-AAV. This plasmid was used for microscopy tracking experimentsDepositorUseSynthetic BiologyTagsFused by GS linker to LZx domain and Venus has N-…ExpressionBacterialAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDD2000
Plasmid#101197PurposeName: pBluescript-LANApi,K14. Bidirectional reporter driving LANApi side [green luciferase isoform from pCBG68] and K14 side [red luciferase isoform from pCBR] in pBluescript backbone.DepositorInsertLANApi side [green luciferase isoform of pCBG68], K14 side [red luciferase isoform of pCBR]
UseLuciferaseAvailabilityAcademic Institutions and Nonprofits only -
pML104
Plasmid#67638PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains URA3 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52 and pTDH3Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKSE401
Plasmid#62202PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Kan resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-dDIO hChR2(H134R)-EYFP
Plasmid#55640PurposeDre-Dependent ChR2-EYFPDepositorInserthChR2(H134R)-EYFP
UseAAVTagsEYFPExpressionMammalianPromoterEf1aAvailable SinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pG3H-PE3max-attR1R2
Plasmid#213049PurposeDestination vector Expressing nCas9 and RT fusion protein and carrying Gateway recombination sitesDepositorInsertsCas9 nickase
M-MLV Reverse Transcriptase
UseNote: this plasmid needs helper pvs1-vir2 for rep…ExpressionPlantMutationH840A, R240K, N413K,Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pREP-8xARE-GFP-SV40-BFP
Plasmid#134910PurposeNRF2 reporter plasmid with GFP under control of 8 ARE elements and constitutively transcribed BFPDepositorInserts8xARE- minimal promoter - GFP
TagBFP
ExpressionMammalianPromoter8xARE - minimal promoter and SV40Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSL1142 (pSPIN, pBBR1 backbone)
Plasmid#160730PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA, with BsaI sites for spacer cloning. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSL1425 (pSPIN, pCDF backbone)
Plasmid#160735PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA and has BsaI sites for spacer cloning. pCDF backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHSE401
Plasmid#62201PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pML107
Plasmid#67639PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains LEU2 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52 and pTDH3 (aka GAP promoter)Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSL1521 (pSPIN, pSC101* backbone)
Plasmid#160729PurposeSingle-plasmid V. cholerae CAST system. Encodes all proteins, crRNA, donor DNA; non-targeting crRNA has BsaI sites for cloning. Temperature-sensitive pSC101* backbone can be cured by 37 °C incubation.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pEGFP-hsRPA32 (MSW#497)
Plasmid#208068PurposeExpression of GFP-tagged hsRPA2 in human cellsDepositorAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only