We narrowed to 4,572 results for: erf
-
Plasmid#234450PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4f-NGR-WPRE
Plasmid#234442PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorHas ServiceAAV1InsertiGluSnFR4f-NGR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-PDGFR-WPRE
Plasmid#234435PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4f-PDGFR-WPRE
Plasmid#234446PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterGFAPAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-flex-iGluSnFR4f-PDGFR-WPRE
Plasmid#234448PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-PDGFR-WPRE
Plasmid#234436PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4s-PDGFR-WPRE
Plasmid#234445PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterGFAPAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4f-PDGFR-WPRE
Plasmid#234440PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4s-PDGFR-WPRE
Plasmid#234439PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBig2ab zz TEV YBBR POT1 ZZ TEV TPP1 MBP TEV TIN2 ZZ TEV TRF1 (4comp1)
Plasmid#185447PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF1 and TPP1 each with a zz tag and TEV site, and human TIN2 with an MBP affinity tag and TEV site in insect cellsDepositorTagsMBP, YBBR, and ZZExpressionInsectAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 (plus strand)
Plasmid#91850PurposeLuciferase reporter for IL2RA enhancer (IGI-P0345)DepositorInsertIL2RA CaRE4 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 (minus strand)
Plasmid#91849PurposeLuciferase reporter for IL2RA enhancer (IGI-P0626)DepositorInsertIL2RA CaRE4 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE1 (plus strand)
Plasmid#91837PurposeLuciferase reporter for IL2RA enhancer (IGI-P0614)DepositorInsertIL2RA CaRE1 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PRKR
Plasmid#23452DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE5 (plus strand)
Plasmid#91841PurposeLuciferase reporter for IL2RA enhancer (IGI-P0618)DepositorInsertIL2RA CaRE5 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE5 (minus strand)
Plasmid#91836PurposeLuciferase reporter for IL2RA enhancer (IGI-P0613)DepositorInsertIL2RA CaRE5 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-MYC GAC F7
Plasmid#227828PurposeTo amplify the virus that expresses C-MYC GAC F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertGAC isoform of F7 (GLS Human)
UseLentiviralTagsMYCExpressionMammalianMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GAC F7
Plasmid#227829PurposeTo express in E. coli GAC F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertGAC isoform of F7 (GLS Human)
TagsGSTExpressionBacterialMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHM1 KGA-33A
Plasmid#227836PurposeUsed for microinjection of nematodes for expression of KGA-33A, GLS with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertKGA isoform (GLS Human)
TagsGFPExpressionWormMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only