We narrowed to 16,033 results for: SUB
-
Plasmid#31664DepositorInsertp21-activated protein kinase 2 S20A (PAK2 Human)
UseLentiviralTagsM2ExpressionMammalianMutationChanged Serine 20 to AlanineAvailable SinceApril 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-C-Kbp
Plasmid#178013PurposeBacterial expression of green fluorescent potassium indicator mNG-C-KbpDepositorInsertmNG-C-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-Pa-Kbp
Plasmid#178014PurposeBacterial expression of green fluorescent potassium indicator mNG-Pa-KbpDepositorInsertmNG-Pa-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-Hv-Kbp
Plasmid#178015PurposeBacterial expression of green fluorescent potassium indicator mNG-Hv-KbpDepositorInsertmNG-Hv-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-D-Kbp
Plasmid#178012PurposeBacterial expression of green fluorescent potassium indicator mNG-D-KbpDepositorInsertmNG-D-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Plxnb3-Fc-His
Plasmid#72130PurposeExpresses the extracellular region of the PlexinB3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sema3d(L)-AP-His
Plasmid#72017PurposeExpresses the Sema3D protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGMC00013
Plasmid#172525PurposesgRNA against mouse Mr1DepositorAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cntn4.2-AP-His
Plasmid#71942PurposeExpresses the entire Contactin 2, isoform 2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST_FLAG-HUWE1_YH/GG
Plasmid#187123Purposemammalian cell expression of FLAG-HUWE1 Y355G/H356GDepositorAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(S, +)-AP-His
Plasmid#72023PurposeExpresses the Sema3F protein (truncated at cleavage site P1; ie, short and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntn5.a-Fc-His
Plasmid#72107PurposeExpresses the entire Netrin 5, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 UBXN11
Plasmid#169017PurposeExpresses GST-UBXN11 (human) in bacteriaDepositorAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema3c(L)-Fc-His
Plasmid#72141PurposeExpresses the Sema3C protein (truncated at cleavage site P3; ie, long), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30Xa-SBL1(160S)
Plasmid#66872PurposeExpresses WTsoybean lipoxygenase-1 160S with N-term HistagDepositorInsertsoybean lipoxygenase-1 wild type (NEWENTRY Glycine max)
TagsHistag from pET30Xa-LICExpressionBacterialMutationnonePromoterT7lacAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Plxnc1-Fc-His
Plasmid#72131PurposeExpresses the extracellular region of the PlexinC1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS3_K227/230R
Plasmid#127135DepositorAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS3_K230R
Plasmid#127134DepositorAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS3_K227R
Plasmid#127133DepositorAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only