We narrowed to 14,585 results for: Cas9
-
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCfB6684
Plasmid#106154PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6631, integration into Yarrowia lipolytica chromosomal location IntD_1, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB6682
Plasmid#106152PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6627, integration into Yarrowia lipolytica chromosomal location IntC_2, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
7xNLS-pMJ915v2-sfGFP
Plasmid#88922PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
AP568-3
Plasmid#70048Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRExpressionWormAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX168
Plasmid#89257PurposeExpress STU (Single Transcriptional Unit) Cas9 with CaMV 35s promoter in plantsDepositorTypeEmpty backboneUseCRISPRTagsSV40 NLSExpressionPlantAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLdSaCN
Plasmid#123261PurposeExpresses Staphylococcus aureus Cas9 (SaCas9) and its gRNA in LeishmaniaDepositorInsertgRNA and SaCas9
UseCRISPR; LeishmaniaAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.sfGFP-RepEntry.iPAC
Plasmid#100893PurposeLentiviral CRISPR-Cas9 ReporterDepositorInsertssfGFP
PAC
Available SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AP568-2
Plasmid#70047Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRExpressionWormAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB6679
Plasmid#106158PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6638, integration into Yarrowia lipolytica chromosomal location IntE_4, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB6681
Plasmid#106157PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6637, integration into Yarrowia lipolytica chromosomal location IntE_3, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd SUP
Plasmid#115489PurposeCRISPR-Cas9 SunTag system to target NtDRMcd to the SUPERMAN locus with two guide RNAsDepositorInsertg2_U6_g1_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRU205
Plasmid#167685PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::asCpf1
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU321
Plasmid#167681PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::asCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU320
Plasmid#167682PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::asCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEG302 5aa SunTag VP64 gRNA4 (FWA)
Plasmid#115481PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with a single guide RNADepositorInsertg4_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev2
Plasmid#81207Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEG302 5aa SunTag VP64 gRNA17 (FWA)
Plasmid#115482PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with a single guide RNADepositorInsertg17_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
1xNLS-pMJ915v2-sfGFP
Plasmid#88919PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only