We narrowed to 31,239 results for: PLE;
-
Plasmid#220763PurposeExpression of Sun1GFP for nuclei isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertSun1-GFP-WPRE-BC11
UseAAVPromoterCAGAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEYFP_C1_ATRX
Plasmid#221383PurposeExpresses ATRX in mammalian cellsDepositorInsertTranscriptional regulator ATRX (ATRX Human)
ExpressionMammalianMutationK536N (Please see depositor comments)PromoterCMVAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-Sun1-GFP-WPRE-BC7-pA
Plasmid#220759PurposeExpression of Sun1GFP for nuclei isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertSun1-GFP-WPRE-BC7
UseAAVPromoterCAGAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRF2 CTF-FLAG
Plasmid#217695PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRF2 (ADGRF2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-429Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRE4 CTF-FLAG
Plasmid#217692PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRE4 (ADGRE4P Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-173Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a_DIO_HA/FLAG_muMASS_LF
Plasmid#213394PurposeLoss of function variant of uMASS_1 opioid sensor. AAV virus production for Cre dependent expression.DepositorInsertuMASS_LF
UseAAV and Cre/LoxExpressionMammalianAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_HA_Flag-uMASS_LF
Plasmid#209761PurposeAAV virus production for neuonal expression of uMASS (loss-of-function) under hSyn promoterDepositorInsertuMASS_LF
UseAAVExpressionMammalianAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS44i8GH-1
Plasmid#207525PurposeConditionally-replicating in Pseudomonas vector, high-copy-number; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP; SmR/SpRDepositorInsertoriV(pRO1600/ColE1), xylS, Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP;
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-dMASS_LF_WPRE
Plasmid#209766PurposeAAV virus production for neuronal expression of dMASS_LF (loss-of-function) under hSyn promoterDepositorInsertdMASS_LF
UseAAVExpressionMammalianPromoterhSynAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_HA-Flag-uMASS_1_WPRE
Plasmid#209760PurposeAAV virus production for neuronal expression of uMASS_1 under hSyn promoterDepositorInsertuMASS_1
UseAAVExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-PML peptide
Plasmid#175247PurposeBacterial expression and purification, low affinity SUMOylation substrate with a relatively high Km, can be recruited to FRB with rapamycinDepositorAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-RanGAP*
Plasmid#175237PurposeBacterial expression and purification, low affinity SUMOylation substrate, point mutation F562A reduces affinity for E2, increasing the KmDepositorAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-E2
Plasmid#175243PurposeBacterial expression and purification, E2 enzyme (UBC9) for SUMOylation, can be recruited to FRB with rapamycin, CyPet acts as a FRET donor to YpetDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-RanGAP
Plasmid#175236PurposeBacterial expression and purification, high affinity SUMOylation substrate that can recruited to FRB with rapamycinDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-V9
Plasmid#173797PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene noctiflora ClpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V7
Plasmid#173796PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene latifolia clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V6
Plasmid#173795PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene conica clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V4
Plasmid#173794PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Nicotiana tabacum clpP1 gene with native regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pG418R-MCS-LexA-VP16-MiniWhite
Plasmid#165894PurposeG418 resistant LexA driver vector with Mini-w+ CDS eye marker. Enhancer grammar GB20 entry point for custom enhancers. Cut-and-paste cloning can be used. Purple-white bacteria colony screening.DepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only