We narrowed to 28,272 results for: STI;
-
Plasmid#114083PurposeCAG promoter expression plasmid for human codon optimized enAsBE1.3DepositorInsertDNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to N-terminal rAPOBEC1 and C-terminal UGI (enAsBE1.3)
TagsSV40 NLSExpressionMammalianMutationE174R, S542R, K548R and D908A, human codon optimi…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-RVR(S542R/K548V/N552R)-NLS(nucleoplasmin)-6xHis (AAS1897)
Plasmid#114074PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-RVR(S542R/K548V/N552R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-RVR (S542R/K548V/N552R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationS542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
The Human Druggable CRISPR library
Pooled Library#200013PurposeKnockout library containing ~10,000 sgRNAs targeting 1,980 human druggable genes (5 sgRNAs per gene and 100 non-targeting control sgRNAs).DepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lourido Toxoplasma CRISPR Library V1
Pooled Library#80636PurposeKnockout library targeting 8,158 predicted protein-coding gene in Toxoplasma gondii.DepositorAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
E. coli BL21 (DE3) ΔEntD
Bacterial Strain#192874PurposeDeletion of native E. coli EntD, a 4'-PPTase required for native enterobactin synthesis. Allows expression of NRPS carrier proteins that do not harbor a phosphopantetheinyl group.DepositorBacterial ResistanceNoneSpeciesEscherichia coliAvailable SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNJP
Plasmid#115494PurposeExpression vector for NLS-iRFP-NLS, JNK KTR-mCherry, and mKO-MK2 in mammalian cellsDepositorTagsiRFP, mCherry, and mKOExpressionMammalianMutationmCherry S227F, mCherry G229R, mKO V211GPromoterCAGAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Watermelon
Pooled Library#155257PurposeLineage tracing libraryDepositorExpressionMammalianUseLentiviralAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human Transporter Knockout Library with UMIs
Pooled Library#221409PurposegRNA library to test the impact of transporters on biological processesDepositorSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only