We narrowed to 23,392 results for: HAL
-
Plasmid#121704PurposepMVP L5-L4 entry plasmid, contains myc epitope tag for 4-component MultiSite Gateway Pro assembly. Allows N-term epitope tag fusion to gene of interest.DepositorInsertmyc epitope tag (open)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG703: pMVP (L5-L4) 6x His epitope tag
Plasmid#121706PurposepMVP L5-L4 entry plasmid, contains 6x His epitope tag for 4-component MultiSite Gateway Pro assembly. Allows N-term epitope tag fusion to gene of interest.DepositorInsert6x His epitope tag (open)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IO801: pMVP (L5-L4) 3x FLAG epitope tag
Plasmid#121702PurposepMVP L5-L4 entry plasmid, contains 3x FLAG epitope tag for 4-component MultiSite Gateway Pro assembly. Allows N-term epitope tag fusion to gene of interest.DepositorInsert3x FLAG epitope tag (open)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-SOMA-T679A
Plasmid#118936PurposeUsed to express the T679A mutant form of the SOMA FRET sensor in E. coli.DepositorInsertSOMA FRET sensor for measuring MAPK activity in Arabidopsis thaliana with T679A Mutation
ExpressionBacterialAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_MIER3_2
Plasmid#86324PurposeEncodes gRNA for 3' target of human MIER3DepositorInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_1
Plasmid#86321PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HMG20A_2
Plasmid#86319PurposeEncodes gRNA for 3' target of human HMG20ADepositorInsertgRNA against HMG20A (HMG20A Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_1
Plasmid#86314PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_MIER3_1
Plasmid#86323PurposeEncodes gRNA for 3' target of human MIER3DepositorInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_2
Plasmid#86322PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HMG20A_1
Plasmid#86318PurposeEncodes gRNA for 3' target of human HMG20ADepositorInsertgRNA against HMG20A (HMG20A Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_2
Plasmid#86315PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KAT7_1
Plasmid#86309PurposeEncodes gRNA for 3' target of human KAT7DepositorInsertgRNA against KAT7 (KAT7 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_HMG20A
Plasmid#86271PurposeDonor vector for 3' FLAG tag of human HMG20ADepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KLF11
Plasmid#86269PurposeDonor vector for 3' FLAG tag of human KLF11DepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTYB3-human PUM1-HD MUT7-1 (E1083Q)-intein-CBD
Plasmid#73303PurposeExpresses mutant human PUM1-HDDepositorInserthuman PUM1 Pumilio homology domain (PUM1 Human)
TagsinteinExpressionBacterialMutationE1083QAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTYB3-human PUM1-HD MUT7-2 (S1079N-E1083Q)-intein-CBD
Plasmid#73299PurposeExpresses mutant human PUM1-HDDepositorInserthuman PUM1 Pumilio homology domain (PUM1 Human)
TagsinteinExpressionBacterialMutationS1079N-E1083QAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK GPR137B 3'UTR
Plasmid#19864DepositorInsertGPR137B 3'UTR (GPR137B Human)
ExpressionMammalianAvailable SinceJan. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAtVPZv1.0
Plasmid#233147PurposeExpresses VDE, PsbS, ZEP from A.thalianaDepositorInsertsExpressionPlantPromoterFBA-2, GAPA-1, Rbcs1a, and mas promoterAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only