We narrowed to 1,382 results for: ncl
-
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-CLN3_STOP
Plasmid#161034PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertCLN3 (CLN3 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1951
Plasmid#105868PurposeHigh copy number plasmid containing Hspa1a (synonym Hsp68) MiniPromoter insertDepositorAvailable SinceFeb. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_CLN3
Plasmid#131868PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertCLN3 (CLN3 Human)
ExpressionMammalianAvailable SinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCW57-mCherry-2A-BRD4 Iso AdelCTD
Plasmid#137722PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long isoform missing its C-terminal, P-TEFb interacting domain (CTD)DepositorInsertBRD4 long isoform without its C-terminal, P-TEFb interacting domain (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationTruncated at amino acid 1328PromoterTight TRE promoterAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW57-mCherry-2A-BRD4 Iso CdelET
Plasmid#137723PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long short missing its extra-terminal domain (ET)DepositorInsertBRD4 short isoform with deleted extra-terminal domain (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationDeleted amino acids 600-682PromoterTight TRE promoterAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
ERK1C82C202
Plasmid#164650PurposeBacterial expression plasmid for His6-ERK1C82C202DepositorInsertERK1C82C202 (MAPK1 Human)
TagsHis6-tagExpressionBacterialMutationK71R/C144S/C178S/C183S/T202C/C271SPromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS1401
Plasmid#29198PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP reporterDepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1538
Plasmid#29261PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving a lacZ reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEMHE-RnCENP-O-203-GFP
Plasmid#205183PurposeExpresses chimeric rat CENP-O with mouse CENP-O middle region including central RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O middle regi…PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Aro--
Plasmid#169716PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids.DepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Perfect Mix
Plasmid#169718PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids. TYR and PHE shuffled into 5 clusters.DepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Aro-
Plasmid#169715PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids.DepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Aro+
Plasmid#169717PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids. PHE and TYR amino acids shuffled to optimize mixing.DepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Patchy
Plasmid#169719PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids.DepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Δ1-60MEK1C222
Plasmid#164641PurposeBacterial expression plasmid for His6-ΔMEK1C222DepositorInsertN-terminal truncated mitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationS222C/C277S/C376S; residues 1-60 at N-terminus we…PromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
Δ1-60MEK1C218
Plasmid#164643PurposeBacterial expression plasmid for His6-ΔMEK1C218DepositorInsertN-terminal truncated mitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationS218C/C277S/C376S; residues 1-60 at N-terminus we…PromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
Δ1-60MEK1C218C222
Plasmid#164645PurposeBacterial expression plasmid for His6-ΔMEK1C218C222DepositorInsertN-terminal truncated mitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationS218C/S222C/C277S/C376S; residues 1-60 at N-termi…PromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS1132
Plasmid#29053PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP/Cre fusion reporterDepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only