We narrowed to 11,753 results for: ARIA;
-
Plasmid#159685PurposeMammalian protein expression of HRAS HVR (Hypervariable region)-Halotag fusionDepositorAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only
-
R713-M48-303: CMV51p> Halotag-Kras4aHVR
Plasmid#159684PurposeMammalian protein expression of KRAS4a HVR (Hypervariable region)-Halotag fusionDepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
R703-M80-303: CMV51p> Halotag-Kras4bHVR
Plasmid#159683PurposeMammalian protein expression of KRAS4b HVR (Hypervariable region)-Halotag fusionDepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
R713-M52-303: CMV51p> Halotag-NRasHVR
Plasmid#159686PurposeMammalian protein expression of NRAS HVR (Hypervariable region)-Halotag fusionDepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.1.7-AVI
Plasmid#176325PurposeExpresses SARS-CoV-2 S2P protein from the B.1.1.7 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.1.7 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutation69-70 del, 144del, N501Y, A570D, D614G, P681H, T7…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRRL-MND-hCard11 R72L-T2A-GFP
Plasmid#163784PurposeExpression of R72L CARD domain variantDepositorAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-BA.2-AVI
Plasmid#184532PurposeExpresses SARS-CoV-2 NTD domain from the BA.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-BA.2 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT19I, L24-, P25-, P26-, A27S, G142D, V213GAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.351-AVI
Plasmid#176326PurposeExpresses SARS-CoV-2 S2P protein from the B.1.351 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.351 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, D80A, D215G, 242-244del, R246I, K417N, E484…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-P.1-AVI
Plasmid#176429PurposeExpresses SARS-CoV-2 NTD domain from the P.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-P.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, T20N, P26S, D138Y, R190SAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-P.1-AVI
Plasmid#176327PurposeExpresses SARS-CoV-2 S2P protein from the P.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-P.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, T20N, P26S, D138Y, R190S, K417T, E484K, N50…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.351
Plasmid#171749PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-B.1.351 variant (South African)DepositorInsertSpike (S-GSAS-B.1.351 variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-BJ.1-AVI
Plasmid#196617PurposeExpresses SARS-CoV-2 RBD protein from the BJ.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-BJ.1
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG339H, R346T, L368I, S371F, S373P, S375F, T376A, …Available SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-C.37-AVI
Plasmid#181702PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL452Q, F490SAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-B.1.621-AVI
Plasmid#181703PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-B.1.621 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationR346K, E484K, N501YAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-C.37-AVI
Plasmid#181699PurposeExpresses SARS-CoV-2 RBD domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL452Q, F490SAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-B.1.621-AVI
Plasmid#181700PurposeExpresses SARS-CoV-2 RBD domain from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-B.1.621 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationR346K, E484K, N501YAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.621-AVI
Plasmid#181694PurposeExpresses SARS-CoV-2 S2P protein from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.621 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, insert144T, Y144S, Y145N, R346K, E484K, N50…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only