We narrowed to 8,876 results for: sgrna
-
Plasmid#232455PurposeLentiviral, CRISPR sgRNA for PCSK5DepositorInsertPCSK5 sgRNA (PCSK5 Human)
UseCRISPR and LentiviralAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKO024.306-107
Plasmid#242927PurposeExpression of a Sth1-dCas9 compatible MS2 scRNA J306 and a Spy-dCas9 compatible sgRNA J107DepositorInsertsgRNA J107
UseCRISPR and Synthetic BiologyPromoterBba_J23119Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Scramble_gRNA_puro
Plasmid#234999Purposescramble sgRNADepositorInsertscramble sgRNA
UseLentiviralTagsEGFP:T2A:PuroExpressionMammalianAvailable SinceJuly 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(A)
Plasmid#236038PurposeThe plasmid pQdCas12a.sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (A) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
GMR11F02-Gal4 UAS-GFP
Plasmid#230907PurposeTissue-specific expression of GFP in wing and haltere imaginal discs.DepositorInsertGFP
ExpressionInsectPromoterGMR11F02Gal4-UASAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only