We narrowed to 16,171 results for: grna
-
Plasmid#208570PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(21))-PGKpuroBFP-W
Plasmid#200507PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(23))-PGKpuroBFP-W
Plasmid#200508PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(47))-PGKpuroBFP-W
Plasmid#200505PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAT_g1 gRNA
Plasmid#86005Purposeplasmid vector encoding for U6-driven AAT_g1 gRNADepositorInsertpU6-AAT_g1 sgRNA
UseCRISPRExpressionMammalianPromoterpU6Available sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAT_g2 gRNA
Plasmid#86006Purposeplasmid vector encoding for U6-driven AAT_g2 gRNA (Z-allele specific)DepositorInsertpU6-AAT_g2 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-1-3'
Plasmid#117324PurposeCRISPR-Cas9 for miR-124-1, 3'DepositorAvailable sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(-10TC)_Psyn-sgRNA500
Plasmid#149583Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Neg. Ctrl_sgRNA
Plasmid#111298PurposeCRISPR KO murine neg. ctrl.DepositorInsertNegCtrl sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_PflaBS-sgRNA500
Plasmid#149615PurposegRNA expression in B. burgdorferi, parental vectorDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaBSAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUFM1 sgRNA2 (UFM1 Human)
ExpressionMammalianAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA1
Plasmid#134633Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUFM1 sgRNA1 (UFM1 Human)
ExpressionMammalianAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLK4 G8.1 gRNA
Plasmid#90837Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorInsertPLK4 (Guide Designation G8.1)
UseCRISPR and LentiviralPromoterU6Available sinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLK4 G7.1 gRNA
Plasmid#90836Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorInsertPLK4 (Guide Designation G7.1)
UseCRISPR and LentiviralPromoterU6Available sinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MIS18BP1 F10.1 gRNA
Plasmid#90769Purpose3rd generation lentiviral gRNA plasmid targeting human MIS18BP1DepositorInsertMIS18BP1 (Guide Designation F10.1)
UseCRISPR and LentiviralPromoterU6Available sinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MCM6 E1.2 gRNA
Plasmid#90762Purpose3rd generation lentiviral gRNA plasmid targeting human MCM6DepositorInsertMCM6 (Guide Designation E1.2)
UseCRISPR and LentiviralPromoterU6Available sinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MASTL F4.1 gRNA
Plasmid#90753Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation F4.1)
UseCRISPR and LentiviralPromoterU6Available sinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only