We narrowed to 11,871 results for: KIN
-
Plasmid#50909PurposeExpresses human NKCC1 C723S C724V W733C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationC723S C724V W733C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V F728C (NT542)
Plasmid#50906PurposeExpresses human NKCC1 C723S C724V F728C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationC723S C724V F728C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V M727C (NT540)
Plasmid#50905PurposeExpresses human NKCC1 C723S C724V M727C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationC723S C724V M727C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C N-terminal deletion (NT96)
Plasmid#50914PurposeExpresses human NKCC1 with truncation of N-terminus and mutations at P676C I730C. Contains an N-terminal 3xFLAG-YFP tag for expression in mammalian cellsDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationP676C I730C N-term deletion of aa13-222 in hNKCC1…PromoterCMVAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A675C C723S C724V A735C (NT847)
Plasmid#50865PurposeExpresses human NKCC1 A675C C723S C724V A735C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationA675C C723S C724V A735C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
plIG-110_CD19-BBz_CAR_TF_Library
Pooled Library#207477PurposeCD19-BBz CAR in combination with 100 transcription factors (and related proteins) and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into theDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-132_CD19-28z_CAR_TF_and_SR_Library
Pooled Library#207481PurposeCD19-28z CAR in combination with 129 surface receptors, 100 transcription factors (and related proteins) and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knocDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-106_NY-ESO-1_TCR_SR_Library
Pooled Library#207474PurposeNY-ESO-1 TCR in combination with 129 surface receptors and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into the TRAC locus of human T cellsDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-107_NY-ESO-1_TCR_TF_Library
Pooled Library#207475PurposeNY-ESO-1 TCR in combination with 100 transcription factors (and related proteins) and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into theDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-124_HA-GD2-28z_CAR_SR_Library
Pooled Library#207479PurposeHA-GD2-28z CAR in combination with 129 surface receptors and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into the TRAC locus of human T celDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), M163A (EcI) MetNIQ in pBAD
Plasmid#118261PurposeN295A Mutation of MetN and M163A in MetI in Methionine ABC Transporter and Wild Type Methionine Binding Protein for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala) …PromoterNone and araBAD PromoterAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), M107A (EcI) MetNIQ in pBAD
Plasmid#118259PurposeN295A Mutation of MetN and M107A in MetI in Methionine ABC Transporter and Wild Type Methionine Binding Protein for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala) …PromoterNone and araBAD PromoterAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), F103A (EcI) MetNIQ in pBAD
Plasmid#118258PurposeN295A Mutation of MetN and F103A in MetI in Methionine ABC Transporter and Wild Type Methionine Binding Protein for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala) …PromoterNone and araBAD PromoterAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP miSFIT Lineage Barcoding Library
Pooled Library#229136PurposeThe EGFP_miSFIT_Lineage_BC_lib library is a transcribed lineage barcoding vector library.DepositorExpressionMammalianUseLentiviralAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N-terminus T,S mutations P676C I730C (NT95)
Plasmid#50913PurposeExpresses human NKCC1 with mutated Ser and Thr residues in the N-terminus and mutations at P676C I730C. Contains N-terminal 3xFLAG-YFP tag for expression in mammalian cellsDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationS150N S155Q S170Q T177A S183R S193E T203A T205A T…PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJK215
Plasmid#72427PurposeAcetobacter aceti 1023 gDNADepositorInsertssuccinyl-diaminopimelate desuccinylase
2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase
acetylglutamate kinase
ribosome biogenesis GTP-binding protein YsxC
insertase
ribonuclease P
50S ribosomal protein L34
hypothetical protein
glyoxylase I
hypothetical protein
UDP-N-acetylglucosamine acyltransferase
3-hydroxyacyl-ACP dehydratase
UDP-3-O-(3-hydroxymyristoyl) glucosamine N-acyltransferase
UsePhage lambda cloning vector with genomic dna inse…Mutationmissing C-terminal domain residues 277-391(ter) a…Promotern/aAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C N-terminal deletion C-terminus replaced NBCe C-terminus (NT94)
Plasmid#50912PurposeExpresses human NKCC1 with truncation of N-terminus, mutations at P676C I730C and C-terminus replaced with that of NBCe. Contains an N-terminal 3xFLAG-YFP tag for expression in mammalian cellsDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationP676C and I730C; N-term deletion of aa13-222; C-t…PromoterCMVAvailable SinceFeb. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only