We narrowed to 2,589 results for: GCG
-
Plasmid#90902Purpose3rd generation lentiviral gRNA plasmid targeting human SRSF2DepositorInsertSRSF2 (Guide Designation A9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
SRSF2 A10.3 gRNA
Plasmid#90903Purpose3rd generation lentiviral gRNA plasmid targeting human SRSF2DepositorInsertSRSF2 (Guide Designation A10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
UNG D12.3 gRNA
Plasmid#90937Purpose3rd generation lentiviral gRNA plasmid targeting human UNGDepositorInsertUNG (Guide Designation D12.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago1_3
Plasmid#73535PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertAGO1
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna7-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128342PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-5
Plasmid#109011PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
CBX5 A1.5 gRNA
Plasmid#90570Purpose3rd generation lentiviral gRNA plasmid targeting human CBX5DepositorInsertCBX5 (Guide Designation A1.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
KMT5A H1.3 gRNA
Plasmid#90726Purpose3rd generation lentiviral gRNA plasmid targeting human KMT5ADepositorInsertKMT5A (Guide Designation H1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
HJURP E3.1 gRNA
Plasmid#90710Purpose3rd generation lentiviral gRNA plasmid targeting human HJURPDepositorInsertHJURP (Guide Designation E3.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi sgSOS1-2
Plasmid#253093PurposeCRISPRi single-guide against SOS1DepositorInsertSOS1 (SOS1 Human)
UseCRISPRAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPU_sgRNA_5
Plasmid#242900PurposePiggyBac cargo vector with HNRNPU sgRNA 5 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-TLS-PtALSgRNA
Plasmid#245881PurposeGolden gate entry vector carrying the gRNA for base editing in Poplar hybrid ALS gene along with TLS mobile RNA sequenceDepositorInsertPtALSgRNA
UseCRISPRExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-Fgf5Pro
Plasmid#227480Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-Fgf5Pro
Plasmid#227481Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-PrPro
Plasmid#227455Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-PrPro
Plasmid#227456Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shPP1C #1
Plasmid#198762Purposeconditional knockdown of PP1CDepositorInsertshPP1C #1 (PPP1CC Human)
ExpressionMammalianAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA3_dTet_mTurquoise2
Plasmid#189806PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA3 (Runx3 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only