We narrowed to 16,291 results for: grna
-
Plasmid#200060PurposeLentiviral vector for expression of sgRNA with mCherry, zeocin resistance, BlpI + BstXI cloning sitesDepositorInsertBleomycin resistance, mCherry
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPUR-mU6-sgRNA-2XPP7
Plasmid#194504PurposeEmpty backbone for sgRNA-2XPP7 in CRIPSR FISHer systemDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-pegRNA-RNF2_+5GtoT
Plasmid#135957PurposeS. pyogenes pegRNA for +5 G to T edit at the RNF2 site of human cells using prime editingDepositorInsertRNF2_5GtoT pegRNA
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV sgRNA Expression Plasmid
Plasmid#174540PurposeContains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.DepositorTypeEmpty backboneUseAAVTagsNoneExpressionMammalianPromoterCMVAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti SpBsmBI sgRNA Puro
Plasmid#62207PurposeAn empty sgRNA expression vector for expression of sgRNA for Sp Cas9 (3rd generation lentiviral vector)DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6Available SinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUF-Cas9-pre-sgRNA
Plasmid#137845PurposeCas9 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK2/PKR_sgRNA
Plasmid#218527PurposesgRNA targeting human EIF2AK2/PKRDepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS79 (eft-3p::Cas9 + sgRNA)
Plasmid#154839PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGGDepositorInsertsgRNA
UseCRISPRExpressionWormAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR8-PspCas13b_gRNA[ccdbCam]_1xMS2b
Plasmid#196847Purposebackbone for gRNA cloning of dpspCas13b tagged by 1xMS2DepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKVL2-U6gRNA_SAM(BbsI)-PGKpuroBFP-W
Plasmid#112925PurposeLentiviral vector for SAM-CRISPRa gRNA expression with puroBFPDepositorInserthU6 promoter, gRNA-SAM expression cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Hic1 GFP
Plasmid#106953PurposeLentivirus encoding sgRNA targeting murine Hic1. Includes GFP marker.DepositorInsertanti-Hic1 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-U6-sgRNA-CMV-puro
Plasmid#169450Purposebackbone for sgRNA expressionDepositorInsertsgRNA
UseLentiviralAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK3/PERK_sgRNA
Plasmid#218666PurposesgRNA targeting human EIF2AK3/PERKDepositorInsertEIF2AK3 (EIF2AK3 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK1/HRI_sgRNA
Plasmid#218529PurposesgRNA targeting human EIF2AK1/HRIDepositorInsertEIF2AK1 (EIF2AK1 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
1179_pAAV-U6-BbsI-gRNA-CB-EmGFP
Plasmid#89060PurposeAAV-gRNA cloning vector with GFP reporterDepositorInsertEmGFP
UseAAV and CRISPRExpressionMammalianPromoterChicken beta actin with partial CMV enhancerAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only