251,588 results
-
Plasmid#85102PurposeP450 BM3 variant (A74G/C773S/C810S)DepositorInsertP450 BM3
UseCloning vectorMutationA74G/C773S/C810SAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBsaBM3
Plasmid#85102PurposeP450 BM3 variant (A74G/C773S/C810S)DepositorInsertP450 BM3
UseCloning vectorMutationA74G/C773S/C810SAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PEmax-P2A-hMLH1dn
Plasmid#174828PurposeMammalian expression of SpCas9 PEmax prime editor with P2A-human MLH1dn (codon optimized)DepositorInsertPEmax-P2A-hMLH1dn
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationDetailed in manuscript; deletion of residues 754-…PromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTol1-UAS:GtACR2-tdTomato
Plasmid#124236PurposeZebrafish Tol1 construct for UAS-mediated expression of the optogenetic opsin GtACR2 fused to the red fluorescent protein tdTomatoDepositorInsertGtACR2-tdTomato
UseZebrafish expressionTagstdTomatoPromoter14xUAS-E1bAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTol1-UAS:GtACR2-tdTomato
Plasmid#124236PurposeZebrafish Tol1 construct for UAS-mediated expression of the optogenetic opsin GtACR2 fused to the red fluorescent protein tdTomatoDepositorInsertGtACR2-tdTomato
UseZebrafish expressionTagstdTomatoPromoter14xUAS-E1bAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBAD-LacI
Plasmid#46394PurposeOverproduction of LacIDepositorInsertLacI
Tags6xHIS tagExpressionBacterialMutationsilent T to C mutation at position 19Promoterarabinose promoterAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBAD-LacI
Plasmid#46394PurposeOverproduction of LacIDepositorInsertLacI
Tags6xHIS tagExpressionBacterialMutationsilent T to C mutation at position 19Promoterarabinose promoterAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-RA
Plasmid#211705PurposeExpression of a dimerization-dependent fluorescent protein (ddFP) subunit (RA) fused with plasma membrane (PM) targetting motif of Lck in mammalian cellsDepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHCMV_ZIKV_PrME
Plasmid#207316PurposeMammalian expression of Zika virus PrME proteinDepositorInsertZIKV_PrME (POLY Zika virus)
ExpressionMammalianMutationmammalian codon optimizationPromoterCMV promoterAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-UBE4B
Plasmid#113499PurposeExpression of human UBE4B with N-terminal GFP tagDepositorAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-UBE4B
Plasmid#113499PurposeExpression of human UBE4B with N-terminal GFP tagDepositorAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sabatini/Lander Lab Activity-Optimized Genome-wide Human sgRNA Library in lentiCRISPR v1
Pooled Library#1000000100PurposeCRISPR gRNA knockout pooled library (version 1) for targeting the human genomeDepositorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmiRFP680-T2A-HO1
Plasmid#197244PurposeExpresses the protein of wmiRFP680-T2A-HO1 in neurons of C eleganDepositorInsertwmiRFP680-T2A-HO1
ExpressionWormAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109314PurposePlasmid for liver-specific expression of AAV SaCas9 with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109314PurposePlasmid for liver-specific expression of AAV SaCas9 with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
Thy1 promoter construct
Plasmid#20736DepositorInsertThy1 promoter (Thy1 Mouse)
ExpressionMammalianAvailable SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
Thy1 promoter construct
Plasmid#20736DepositorInsertThy1 promoter (Thy1 Mouse)
ExpressionMammalianAvailable SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
phCMV-coGALVenv-C4070A
Plasmid#172217PurposeExpresses the envelope protein of Gibbon Ape Leukemia Virus (GALV) for pseudotyping of retroviral or lentiviral vectorsDepositorInsertEnvelope protein of Gibbon Ape Leukemia Virus (codon-optimized version)
ExpressionMammalianMutationCarries C-terminus of amphotropic MLV strain 4070…PromoterCMV immediate early promoterAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF3015
Plasmid#144491PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only