169,450 results
-
Viral Prep#100854-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (#100854). In addition to the viral particles, you will also receive purified pAAV.Syn.NES-jRGECO1a.WPRE.SV40 plasmid DNA. Synapsin-driven GECO1a calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pPAP004
Plasmid#160911PurposeE.coli/ P.pastoris shuttle plasmid for episomal expression in P.pastorisDepositorInsertlacZ selection cassette
ExpressionYeastAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-Luciferase-IRES-Blast-WPRE
Plasmid#108542PurposeLentivirus vector expressing Luciferase with blasticidin resistanceDepositorInsertsLuciferase
Neomycin
UseLentiviralPromoterEF1apha and PGKAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple GaoA
Plasmid#196051PurposeEncodes a G alpha subunit (GNAO1 Isoform Alpha 1) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensorDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-R-iLACCO1
Plasmid#208025PurposeBiosensor for intracellular L-lactateDepositorInsertR-iLACCO1
ExpressionMammalianAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-sRGN3.1-BlastR
Plasmid#220964PurposeExpresses human codon-optimized sRGN3.1DepositorInsertsRGN3.1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNP3440 [pNP2922 - ISCro4 bRNA (TBL2, WT + DBL1, WT) + ISCro4 Recombinase (WT)]
Plasmid#247263PurposeExpress ISCro4 recombinase and bridge RNADepositorInsertpNP2922 - ISCro4 bRNA1-179 (WT, TBL2 + DBL1)
ExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28a-hPKM2
Plasmid#44242DepositorAvailable SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3CA-H1047R
Plasmid#116500PurposeLentiviral expression of PIK3CA H1047RDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-DTR-GFP
Plasmid#124364Purposeconditional expression of a diphtheria toxin receptor (DTR)–GFP fusion proteinDepositorHas ServiceAAV2InsertDTR-GFP
UseAAVTagsGFPPromoterChicken B-actinAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SynB
Plasmid#174861PurposeExpresses mouse syncytin B in mammalian cellsDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pE-FLP
Plasmid#45978PurposeExpresses yeast Flp driven by the constitutive promoter pE from phage P2DepositorInsertflp
UseSynthetic BiologyExpressionBacterialMutationflp driven by the constitutive promoter pE from p…PromoterpE (from phage P2)Available SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKK-BiFC-Venus
Plasmid#105804PurposeConcomitant expression of two proteins in fusion with fragments of Venus protein. Protein interactions studies by bimolecular fluorescence complementation (BiFC), including BiFC-FRET assays.DepositorTypeEmpty backboneUseFlp-in competentTagsVN173 (I152L); VC155ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Parkin
Plasmid#23956PurposeMammalian expression of human Park2 fused to mCherryDepositorAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
nuclear NAD+ biosensor
Plasmid#186789PurposeNAD+ biosensor comprised of a circularly permuted Venus fluorescent protein (cpVenus), a bipartite NAD+-binding domain modeled from bacterial DNA ligase, and a localization tag to target the nucleusDepositorInsertnuclear NAD+ biosensor
UseLentiviralExpressionMammalianAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIB4
Plasmid#25453DepositorInsertPichia pastoris HIS4 (PAS_chr1-4_0160 Pichia pastoria)
UsePichia pastoris expressionAvailable SinceFeb. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
GFP-AHPH-DM
Plasmid#71368PurposeLocation sensor for RhoA-GTPDepositorInsertC terminus of Anillin (ANLN Human)
TagsEGFPExpressionMammalianMutationA740D and E758KPromoterCMVAvailable SinceNov. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
L_NLS 41kDa
Plasmid#201342PurposeNucleocytoplasmic transport probeDepositorInsert(NLS)SV40A4-EGFP-2PrA
ExpressionMammalianAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-cGAS-N-HA (murine)
Plasmid#130916PurposeExpresses murine cGAS N terminus(aa1-147)-HA; Puromycin selection markerDepositorInsertmurine cGAS N terminus
TagsHAExpressionMammalianMutationmurine cGAS N terminus (aa 1-147)PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only