We narrowed to 34,203 results for: IND;
-
Plasmid#225709PurposePan-neuronal, pan-membrane expression of the genetically encoded voltage indicator ASAP5; can be used for dendritic voltage imagingDepositorInsertASAP5
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2alpha-P405A/P531A-pcDNA3
Plasmid#18956DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
TagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
MGAT2-RpHLuorin2
Plasmid#171718PurposeCis-/medial-Golgi expression of ratiometric pHLuorin2DepositorInsertRatiometric pHLuorin2 fused to MGAT2 (MGAT2 Human)
Tagsratiometric pHluorin2ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-mito-R-GECO1
Plasmid#46021PurposeRed intensiometric genetically encoded Ca2+-indicators for optical imagingDepositorInsertR-GECO1
Tagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationSubstitutions relative to the mApple-derived anal…PromoterCMVAvailable SinceJuly 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-ASAP5-Kv2.1-WPRE
Plasmid#225707PurposePan-neuronal soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV1InsertASAP5-Kv2.1
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE
Plasmid#225708PurposeCre dependent soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV9InsertASAP5-Kv2.1
UseAAVPromoterEF1αAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_CR_T221E
Plasmid#108108PurposeLentiviral expression plasmid of human SIK3 cDNA (CRISPR-resistant silent mutation & TE mutation at LKB1 phosphorylation site) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationchange guanine 501 to cytosine (silent mutation),…PromoterEFS promoterAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
iCas
Plasmid#84232PurposeExpression of SpCas9 with 4 ERT2 fusion protein and empty gRNA cassette. The activity of Cas9 can be switched on and off in human cells with 4-hydroxytamoxifen (4-HT)DepositorInsertCas9
Tags2A-OFP co-expression and ERT2-ERT2ExpressionMammalianPromoterCMVAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCherry-eDHFR-Cdc42Q61L
Plasmid#107267PurposemCherry-eDHFR-Cdc42Q61L in pIVT vector for in vitro transcription. Note that Cdc42 in this plasmid keeps its CAAX domain.DepositorAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
ET8-GPIba-6His
Plasmid#102878PurposeWild type human platelet membrane protein GPIb alpha (1-290aa) with 6Histag at the C-terminusDepositorInsertHuman platelet membrane protein GPIb alpha 1-290aa (GP1BA Human)
Tags6xHis tagExpressionMammalianPromoterCMV promoterAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUW-Gata2
Plasmid#193087Purposeconstitutive expression of mouse Gata2 in mammalian cellsDepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLifeAct-HyPer7
Plasmid#136464PurposeMammalian expression of F-actin targeted ultrasensitive hydrogen peroxide indicator HyPer7 fused with LifeAct peptide for optical imagingDepositorInsertHyPer7
TagsLifeActExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLIX403_control_APOBEC_HA_P2A_mRuby_Capture1
Plasmid#183951PurposeInducible lentiviral expression, TRE-control-APOBEC-HA-P2A-mRuby; PGK-puro-2A-rtTADepositorAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-Casp3-TEV
Plasmid#183766PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The Caspase3 expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene - tetO promoter-flex/DIO-Caspase3-TEV
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianPromotertetO promoterAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-osTIR1
Plasmid#207840PurposeInducible TIR1 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsosTIR
mCherry
mAID_-VHH-GFP4
Tags3X HA-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF1alpha P402A/P564A-pBabe-puro
Plasmid#19005DepositorInsertHypoxia inducible factor 1 alpha (HIF1A Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 402 to Alanin…Available SinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFPZNF598-9P-9A
Plasmid#141192PurposeExpresses GFP-ZNF598 mutated in polyproline streches in mammalian cells, can be used to make inducible cell lineDepositorInsertZNF598 (ZNF598 Human)
TagsGFPExpressionMammalianMutationall 3 proline repeats are mutated to Alanine (9xP…PromoterCMVAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pP{ELAV-GeneSwitch}
Plasmid#83957PurposeExpresses conditional RU486-dependent GAL4 protein under control of the elav promotorDepositorInsertExpressionInsectPromoterelavAvailable SinceDec. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONRp5-p2 GFP-NShroom3-iLID
Plasmid#170976PurposeN-terminal component of OptoShroom3 optogenetic tool. Binds to apical junctions. pDONRp5-p2 plasmid.DepositorInsertNShroom3 (Shroom3 Mouse)
UseGateway cloningTagseGFP and iLIDMutationFrom isoform 2, deleted amino acids 1389 - 1805,…Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only