We narrowed to 12,287 results for: shRNA
-
Plasmid#202046PurposeEncodes PhiYFP downstream of a cloning site for constructing a synthetic Cas-targeted promoter. 3’ UTR has a MALAT1 triplex, dCas12a DRs, and cloning site for crRNA to activate downstream targets.DepositorInsertPhiYFP
ExpressionMammalianAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA376 - pBA904 Puro-T2A-GFP NTC guide (pRCA360 backbone)
Plasmid#238167PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsGFPAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK2
Plasmid#233897Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADK2DepositorInsertsgRNA targeting NADK2 (NADK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry-shScg2-CWB
Plasmid#223659PurposeExpresses hM3D(Gq) and a shRNA targetting Scg2 in a Cre-dependent mannerDepositorInserthM3D(Gq)-mCherry and shScg2
UseAAV and RNAiTagsmCherryExpressionMammalianPromoterhSynAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPH07
Plasmid#234345PurposeLibrary-scale IPTG-inducible gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpKDepositorInsertType II dCas9 sgRNA
UseCRISPRExpressionBacterialPromoterlacUV5Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ITGB6
Plasmid#235244PurposeEncodes gRNA for human ITGB6DepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-TO-g0 (FLP-IN)
Plasmid#236120PurposePlasmid encoding g0 guide RNA under control of CMV promoter with two TetR binding sites, used to equalize plasmid masses for transfectionDepositorInsertg0
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_L31_CRISPR_downstream_sgRNA
Plasmid#235610PurposeEncodes CRISPR gRNA for cleaving downstream of insertion site at C terminus of mouse Rpl31DepositorInsertRpl31 C-terminus downstream sgRNA
UseCRISPRAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_L31_CRISPR_upstream_sgRNA
Plasmid#235609PurposeEncodes CRISPR gRNA for cleaving upstream of insertion site at C terminus of mouse Rpl31DepositorInsertRpl31 C-terminus upstream sgRNA
UseCRISPRAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_SlMIR164b
Plasmid#231152PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting SlMIR164bDepositorInsertTREX2 and mobile gRNA targeting SlMIR164b
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbSTM-5'UTR
Plasmid#231150PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbSTM-5?UTRDepositorInsertmobile gRNA targeting NbSTM-5?UTR
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbPDS
Plasmid#231146PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbPDSDepositorInsertTREX2 and mobile gRNA targeting NbPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-2_NbPDS
Plasmid#231145PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbPDSDepositorInsertTREX2 and mobile gRNA targeting NbPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
esgRNA_NbATML1-2pro and NbATML1-1pro
Plasmid#231155PurposeT-DNA encoding TRV2 with mobile gRNAs targeting NbATML1-2pro and NbATML1-1proDepositorInsertmobile gRNAs targeting NbATML1-2pro and NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIND-GLucZ
Plasmid#228704PurposeInducible expression of Gaussia luciferase and shRNAmir of interestDepositorInsertsGaussia luciferase
non-silencing shRNA
UseLentiviralExpressionMammalianAvailable SinceJan. 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLentiCRISPRRv2_sgTom
Plasmid#218346PurposeCRISPR KO plasmid for tdTomato in human cell linesDepositorInsertInserted sgRNA targeting tdTomato
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only