We narrowed to 16,818 results for: OMP;
-
Plasmid#138126PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized ErCas12a without promoterDepositorInsertErCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD189 VP16-ZF37
Plasmid#138759PurposeConstitutive expression of VP16-ZF37 under the CMV promoter.DepositorInsertVP16-ZF37
UseSynthetic BiologyTags3xFlagExpressionMammalianPromoterCMVAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pecALPS gag-gfp Blasti
Plasmid#115805PurposeExpress gag-gfp fusion driven by EIF1a promoterDepositorInsertgag-gfp
UseLentiviralPromoterEIF1aAvailable sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pJW4.16
Plasmid#62871PurposeBacterial expression of MBP-MBK-2DepositorInsertMBP-MBK-2
TagsMBPExpressionBacterialAvailable sinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AiRTX_ctrl
Plasmid#214069PurposeFluorescent reporter system, NMD negative control. Intron present in 5'UTRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTurboRFP
ExpressionMammalianMutationRemnant of linker sequence present at the end of …Available sinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-D156R (ttLbCas12a)
Plasmid#195366PurposeA temperature-tolerant LbCas12a mutant (D156R), also known as ttLbCas12aDepositorInsertLbCas12a-D156R (ttLbCas12a)
UseCRISPR; Gateway compatible lbcas12a-d156r (ttlbca…ExpressionPlantPromoterZmUBI1Available sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tol2-ISceI-P2:EGFP;cryaa:mCherry-ISceI-Tol2
Plasmid#194515PurposeP2 promoter for transgenic enhancer assays in zebrafishDepositorInsertEnhanced Green Fluorescent Protein
UseZebrafish expressionAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF6 Vps53-V5-6His
Plasmid#175097PurposeV5 tagged Vps53 is expressed in mammalian cellsDepositorAvailable sinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GST FNIP2
Plasmid#164982PurposeFNIP2 expressing vector for mammalian cellsDepositorAvailable sinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNG1299
Plasmid#149709PurposeTemplate for Malachite Green Aptamer (MGA) transcription assayDepositorInsertTriple Promoter - 12X MG Aptamer Array - Terminator construct
UseSynthetic BiologyAvailable sinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
NdeI – SacII – SpeI(NheI) - ANXA2 (23-339)
Plasmid#136543PurposeExpresses ANXA2 chimeras in bacterial cellsDepositorTypeEmpty backboneTagsANXA2 (23-339) and His-tagExpressionBacterialAvailable sinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
psiCHECK c2orf42 3'UTR
Plasmid#19862DepositorInsertc2orf42 3'UTR (C2orf42 Human)
ExpressionMammalianAvailable sinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
SF-U7snRNA-CypA-E4
Plasmid#190695PurposeControl vector expressing a U7-based antisense oligonucleotide targeting CypA exon 4DepositorInsertU7 snRNA antisense CypA Exon 4
UseLentiviralExpressionMammalianPromoterU7 promoterAvailable sinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP10B WT
Plasmid#171770Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B WTDepositorAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG GST DEPDC5
Plasmid#164983PurposeDEPDC5 expressing vector for mammalian cellsDepositorAvailable sinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMH183
Plasmid#122856PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate D-E flanking sequencesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable sinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS-SIV-GOR -vpr
Plasmid#115835PurposeEncodes codon optimized 3xFLAG-SIVGOR Vpr (FJ424871) and puromycin resistance proteinDepositorInsertSIVGOR Vpr (FJ424871)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOPS0379
Plasmid#115510PurposeSuitable for experiments in environments where there is no antibiotic selection present. Symbiosis-induced nifH promoter from Rhizobium leguminosarum biovar vicia 3841 (Rlv3841pNifH) expressing sfGFPDepositorInsertRlv3841pNifH(pOGG082) sfGFP (pOGG037) and T-pharma (pOGG003) assembled in pOGG026
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable sinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only