We narrowed to 12,149 results for: NSI;
-
Plasmid#216515PurposeExpresses MBP-tagged full length hnRNPAB X2DepositorInserthnRNPAB X2 FL
Tags6xHis tags-MBPExpressionBacterialAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-His-SUMO-LS4
Plasmid#228450PurposeLS4 protein expression vector for bacteriaDepositorInsertLS4
Tags10xHis-SUMOExpressionBacterialPromoterT7Available SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-His-SUMO-LS12
Plasmid#228451PurposeLS12 protein expression vector for bacteriaDepositorInsertLS12
Tags10xHis-SUMOExpressionBacterialPromoterT7Available SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Kif1A-EGFP-SNAP
Plasmid#229851PurposeKif1A (aa1-351)-Kif1A neck linker(17aa) fused to Kin1 coiled coil (aa345-406)-EGFP-SNAP-his. This Kif1A was used to link an oligo to the motor using the SNAP tag for single molecule experimentsDepositorAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTYC1_pPromALB_enh5898_FireflyLuc
Plasmid#220285PurposeFirefly luciferase with mouse liver DNase hypersensitive site # 5898 cloned into KpnI/XhoI-digested pPromALB_FireflyLucDepositorInsertmouse liver DNase hypersensitive site # 5898
UseLuciferasePromoterminimal albumin promoterAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTYC2_pPromALB_enh29774_FireflyLuc
Plasmid#220286PurposeFirefly luciferase with mouse liver DNase hypersensitive site # 29774 cloned into KpnI/XhoI-digested pPromALB_FireflyLucDepositorInsertmouse liver DNase hypersensitive site # 29774
UseLuciferasePromoterminimal albumin promoterAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTYC3_pPromALB_enh50363_FireflyLuc
Plasmid#220287PurposeFirefly luciferase with mouse liver DNase hypersensitive site # 50363 cloned into KpnI/XhoI-digested pPromALB_FireflyLucDepositorInsertmouse liver DNase hypersensitive site # 50363
UseLuciferasePromoterminimal albumin promoterAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTYC4_pPromALB_enh50358_FireflyLuc
Plasmid#220288PurposeFirefly luciferase with mouse liver DNase hypersensitive site # 50358 cloned into KpnI/XhoI-digested pPromALB_FireflyLucDepositorInsertmouse liver DNase hypersensitive site # 50358
UseLuciferasePromoterminimal albumin promoterAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJUB2x
Plasmid#208814PurposeEncodes GFP under the control of synthetic promoter responsive to JUB1-derived artificial transcription factor in bacterial cellDepositorInsertTwo copies of JUB1 binding site within the synthetic promoter
UseSynthetic BiologyExpressionBacterialPromoterJUB1 TF-responsive promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNS3_Ptrc::lasR_Plas::mNG
Plasmid#189573PurposeFluorescent reporter for Las activation by 3OC12-HSLDepositorInsertsTranscriptional activator lasR
Monomeric Neon Green
UseSynthetic BiologyExpressionBacterialPromoterlas and trcAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB53
Plasmid#226309PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-3
ExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-coSnaA-TEV-His_His-TEV-SnaC
Plasmid#225059Purposerecombinant expression of SnaA in E. coliDepositorInsertSnaA
ExpressionBacterialPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
WNV NS2B-NS3 protease (catalytically active, self cleave); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204795PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceAug. 29, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRSET-Cm-CspB
Plasmid#215400PurposeCm NCPPB382 cspB codon-optimized for E. coli recombinant protein expression (6xHis-CspB)DepositorInsertcspB
Tags6xHis TagExpressionBacterialPromoterT7 promoterAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSET-Cm-CspA2
Plasmid#215399PurposeCm NCPPB382 cspA2 codon-optimized for E. coli recombinant protein expression (6xHis-CspA2)DepositorInsertcspA2
Tags6xHis TagExpressionBacterialPromoterT7 promoterAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Myc-Caspase-11_humanized-mutant
Plasmid#214316PurposeExpression of gene in mammalian cells by retroviral transductionDepositorAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Myc-Caspase-4_R269D
Plasmid#214310PurposeExpression of gene in mammalian cells by retroviral transductionDepositorAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Myc-Caspase-4_K356D
Plasmid#214309PurposeExpression of gene in mammalian cells by retroviral transductionDepositorAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only