Skip to main content

We narrowed to 7,704 results for: ALP

Showing: 5081 - 5100 of 7704 results
  1. ENOSF1

    Plasmid
    #39104
    Purpose
    Bacterial expression for structure determination; may not be full ORF
    Insert
    ENOSF1 (ENOSF1 Human)
    Tags
    His Tev
    Expression
    Bacterial
    Available Since
    March 18, 2013
    Availability
    Academic Institutions and Nonprofits only
  2. NanoLuc-RBM39 Vector

    Plasmid
    #238729
    Purpose
    Express NanoLuc-RBM39 Fusion Protein in Mammalian Cells under a CMV promoter
    Has Service
    DNA
    Insert
    RBM39 (RBM39 Human)
    Tags
    NanoLuc (R)
    Expression
    Mammalian
    Mutation
    None
    Promoter
    CMV
    Available Since
    Sept. 14, 2025
    Availability
    Industry, Academic Institutions, and Nonprofits
  3. HaloTag-AMPKa Fusion Vector

    Plasmid
    #238637
    Purpose
    Express HaloTag-AMPKa Fusion Protein in Mammalian Cells under a CMV promoter
    Has Service
    DNA
    Insert
    AMPKa (PRKAA1 Human)
    Tags
    HaloTag (R)
    Expression
    Mammalian
    Mutation
    None
    Promoter
    CMV
    Available Since
    Sept. 14, 2025
    Availability
    Industry, Academic Institutions, and Nonprofits
  4. HiBiT-NR1D1 Fusion Vector

    Plasmid
    #238609
    Purpose
    ExpressHiBiT-NR1D1 Fusion Protein in Mammalian Cells under a CMV promoter
    Has Service
    DNA
    Insert
    NR1D1 (NR1D1 Human)
    Tags
    HiBiT
    Expression
    Mammalian
    Mutation
    None
    Promoter
    CMV
    Available Since
    Sept. 14, 2025
    Availability
    Industry, Academic Institutions, and Nonprofits
  5. NR1D1-HiBiT Fusion Vector

    Plasmid
    #238610
    Purpose
    Express NR1D1-HiBiT Fusion Protein in Mammalian Cells under a CMV promoter
    Has Service
    DNA
    Insert
    NR1D1 (NR1D1 Human)
    Tags
    HiBiT
    Expression
    Mammalian
    Mutation
    None
    Promoter
    CMV
    Available Since
    Sept. 14, 2025
    Availability
    Industry, Academic Institutions, and Nonprofits
  6. pYES2/NTA/Leu-LegA7Δank

    Plasmid
    #216519
    Purpose
    Expression of LegA7 ΔAnk
    Depositor
    Insert
    LegA7 ΔAnk
    Tags
    HIS-tag
    Expression
    Bacterial and Yeast
    Mutation
    LegA7 missing aa 331-454
    Available Since
    June 25, 2024
    Availability
    Academic Institutions and Nonprofits only
  7. pYES2/NTA/Leu-LegA7ΔAnk290

    Plasmid
    #216520
    Purpose
    Expression of LegA7 ΔAnk290
    Depositor
    Insert
    LegA7 ΔAnk290
    Tags
    HIS-tag
    Expression
    Bacterial and Yeast
    Mutation
    LegA7 missing aa 290-454
    Available Since
    June 25, 2024
    Availability
    Academic Institutions and Nonprofits only
  8. pYES2/NTA/Leu-LegA7ΔNAnk264

    Plasmid
    #216521
    Purpose
    Expression of LegA7 ΔNAnk264
    Depositor
    Insert
    LegA7 ΔNAnk264
    Tags
    HIS-tag
    Expression
    Bacterial and Yeast
    Mutation
    LegA7 missing aa 264-361
    Available Since
    June 25, 2024
    Availability
    Academic Institutions and Nonprofits only
  9. pYES2/NTA/Leu-LegA7ΔNAnk290

    Plasmid
    #216522
    Purpose
    Expression of LegA7 ΔNAnk290
    Depositor
    Insert
    LegA7 ΔNAnk290
    Tags
    HIS-tag
    Expression
    Bacterial and Yeast
    Mutation
    LegA7 missing aa 290-361
    Available Since
    June 25, 2024
    Availability
    Academic Institutions and Nonprofits only
  10. pUC57_NRAS-5'UTR_Nanoluc

    Plasmid
    #219990
    Purpose
    NRAS-5'UTR-NanoLuc mRNA synthesis
    Depositor
    Insert
    NRAS-5'UTR-NanoLuc (NRAS Human)
    Expression
    Bacterial
    Available Since
    June 20, 2024
    Availability
    Academic Institutions and Nonprofits only
  11. mEos Cav2.2 pMT2

    Plasmid
    #206092
    Purpose
    expression of rabbit Cav2.2 calcium channel with a N-terminal mEos tag
    Depositor
    Insert
    cacna1b (CACNA1B Rabbit)
    Tags
    mEos
    Expression
    Mammalian
    Promoter
    Ad MLP/TPL/SV40
    Available Since
    Nov. 20, 2023
    Availability
    Academic Institutions and Nonprofits only
  12. p2151 pHAGE-hSPC-TFEB-TagBFP-W

    Plasmid
    #188722
    Purpose
    Lentiviral vector allowing for SFTPC-driven expression of TFEB:tagBFP fusion protein
    Depositor
    Insert
    TFEB (TFEB Human)
    Use
    Lentiviral
    Tags
    tagBFP
    Promoter
    hSP-C
    Available Since
    Sept. 22, 2022
    Availability
    Academic Institutions and Nonprofits only
  13. pX459-puro-hCASP8

    Plasmid
    #185378
    Purpose
    For mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)
    Depositor
    Insert
    CASP8 (CASP8 Human)
    Expression
    Mammalian
    Mutation
    WT
    Available Since
    June 8, 2022
    Availability
    Academic Institutions and Nonprofits only
  14. pHAGE-hSPC-TFEB(delta30)eGFP-W

    Plasmid
    #126693
    Purpose
    Lineage specific over expression of a mutated TFEB in lung alveolar epithelial cells, where TFEB is missing the first 30 amino acids of the sequence.
    Depositor
    Insert
    TFEB(delta30) (TFEB Human)
    Use
    Lentiviral
    Mutation
    Deleted amino acids 1-30, H32D, Deleted Stop Codo…
    Promoter
    hSPC
    Available Since
    July 9, 2020
    Availability
    Academic Institutions and Nonprofits only
  15. pKLF10.1.0-gDNA

    Plasmid
    #132433
    Purpose
    CRISPR/Cas9 plasmid to create GFP fusion proteins
    Depositor
    Insert
    KLF10 (KLF10 Human)
    Use
    CRISPR
    Available Since
    Dec. 11, 2019
    Availability
    Academic Institutions and Nonprofits only
Showing: 5081 - 5100 of 7704 results