We narrowed to 7,704 results for: ALP
-
Plasmid#39104PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pICH82113
Plasmid#48073DepositorTypeEmpty backboneUseUnspecifiedAvailable SinceDec. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoLuc-RBM39 Vector
Plasmid#238729PurposeExpress NanoLuc-RBM39 Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertRBM39 (RBM39 Human)
TagsNanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
HaloTag-AMPKa Fusion Vector
Plasmid#238637PurposeExpress HaloTag-AMPKa Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertAMPKa (PRKAA1 Human)
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
HiBiT-NR1D1 Fusion Vector
Plasmid#238609PurposeExpressHiBiT-NR1D1 Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertNR1D1 (NR1D1 Human)
TagsHiBiTExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NR1D1-HiBiT Fusion Vector
Plasmid#238610PurposeExpress NR1D1-HiBiT Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertNR1D1 (NR1D1 Human)
TagsHiBiTExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMpGWB-327-Ef1-MpCKA-K157A-K159A-K160A-K330A-H359A-K362A-TagRFP
Plasmid#238531PurposePlant expression of M. polymorpha CK2 alpha K157A, K159A,K160A, K330A, H359A,K362A, tagged with TagRFPDepositorInsertMpCKA
TagsTagRFPExpressionPlantMutationK157A, K159A,K160A, K330A, H359A,K362AAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJEC637
Plasmid#182956PurposeAD-SYNZIP: αNTD (P. aeruginosa) – SYNZIP17DepositorInsertAlphaNTD( P. aeruginosa) - SynZip17
TagsSynZip17ExpressionBacterialPromoterJ23106Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYES2/NTA/Leu-LegA7Δank
Plasmid#216519PurposeExpression of LegA7 ΔAnkDepositorInsertLegA7 ΔAnk
TagsHIS-tagExpressionBacterial and YeastMutationLegA7 missing aa 331-454Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYES2/NTA/Leu-LegA7ΔAnk290
Plasmid#216520PurposeExpression of LegA7 ΔAnk290DepositorInsertLegA7 ΔAnk290
TagsHIS-tagExpressionBacterial and YeastMutationLegA7 missing aa 290-454Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYES2/NTA/Leu-LegA7ΔNAnk264
Plasmid#216521PurposeExpression of LegA7 ΔNAnk264DepositorInsertLegA7 ΔNAnk264
TagsHIS-tagExpressionBacterial and YeastMutationLegA7 missing aa 264-361Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYES2/NTA/Leu-LegA7ΔNAnk290
Plasmid#216522PurposeExpression of LegA7 ΔNAnk290DepositorInsertLegA7 ΔNAnk290
TagsHIS-tagExpressionBacterial and YeastMutationLegA7 missing aa 290-361Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57_NRAS-5'UTR_Nanoluc
Plasmid#219990PurposeNRAS-5'UTR-NanoLuc mRNA synthesisDepositorInsertNRAS-5'UTR-NanoLuc (NRAS Human)
ExpressionBacterialAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
mEos Cav2.2 pMT2
Plasmid#206092Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal mEos tagDepositorAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
p2151 pHAGE-hSPC-TFEB-TagBFP-W
Plasmid#188722PurposeLentiviral vector allowing for SFTPC-driven expression of TFEB:tagBFP fusion proteinDepositorAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-hSPC-TFEB(delta30)eGFP-W
Plasmid#126693PurposeLineage specific over expression of a mutated TFEB in lung alveolar epithelial cells, where TFEB is missing the first 30 amino acids of the sequence.DepositorInsertTFEB(delta30) (TFEB Human)
UseLentiviralMutationDeleted amino acids 1-30, H32D, Deleted Stop Codo…PromoterhSPCAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLF10.1.0-gDNA
Plasmid#132433PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertKLF10 (KLF10 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUG-TP2
Plasmid#104650PurposeLevel 1 cloning vectorDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUG-TP6
Plasmid#104654PurposeLevel 1 cloning vectorDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only