171,676 results
-
Plasmid#128211Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-shEsr1
Plasmid#120720PurposeLentiviral vector that expresses GFP and an shRNA targeting Esr1 (in pLL3.7).DepositorInsertEsr1 shRNA (Esr1 Mouse)
UseLentiviral and RNAiTagsGFPExpressionMammalianPromoterMouse U6Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-mMcl-1
Plasmid#32980DepositorAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
5HRE/GFP
Plasmid#46926Purposehypoxia-responsive enhanced green fluorescent protein (EGFP)-based systemDepositorInsert5X HRE of VEGF (VEGFA Human)
Tagsd2EGFPExpressionMammalianMutationfive copies of a 35-bp fragment from the hypoxia-…PromoterEF-1α promoterAvailable SinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFH34
Plasmid#126008PurposeLevel0 Arabidopsis AtU6-26 Pol III promoterDepositorInsertLevel0 Arabidopsis AtU6-26 Pol III promoter
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF2303
Plasmid#142019PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
BiDi-[mp-mCherry2]mp-mEGFP
Plasmid#182871PurposeBi-directional expression vector of monomers with plasma membrane localization signalDepositorInsertmyr-palm-mCherry2, myr-palm-mEGFP
ExpressionMammalianAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AtTAS1c-D2-B/c
Plasmid#137883PurposeGateway-compatible entry vector for direct cloning of synthetic trans-acting siRNAs into Arabidopsis thaliana TAS1c precursor at position downstream 3'D1[+]DepositorInsertAtTAS1c-D2-B/c
UseGateway-compatible entry cloneMutationA. thaliana TAS1c precursor sequence including a …Available SinceMay 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK715
Plasmid#114698PurposeExpress NuMA(1-2115)-RFP-Nano from Rosa 26 locusDepositorInsertNuMA(1-2115)-RFP-Nano
Available SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR L1-13XLexAop2-L4
Plasmid#41434DepositorInsert13XLexAop2
ExpressionBacterialAvailable SinceNov. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKB237
Plasmid#170030PurposeEncodes LacI-controlled expression of surface-displayed CCL19 and PvirK-mNeonGreen reporterDepositorArticleInsertsUseSynthetic BiologyTagsLpp, OmpA, and TetherExpressionBacterialPromoterPtac and PvirKAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
KTD101(DE3)
Bacterial Strain#138651PurposeKTD101(DE3) is a trigger factor deficient strain, which may increase protein secretion from Escherichia coli, and is compatible with expression from the T7 promoterDepositorBacterial ResistanceNoneSpeciesEscherichia coliAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMY-mTurquoise2-P2A-PuroR-HA
Plasmid#163344PurposeRetroviral vector to express cytosolic mTurquoise2 and an HA-tagged puromycin selection markerDepositorInsertmTurquoise2
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9715: pHR-PGK-SV40_NLS-dCasMINI-V4-NFZ-c-Myc_NLS-mCherry-WPRE
Plasmid#203221PurposeExpression of dCasMINI-V4-NFZ-mCherry in mammalian cellsDepositorInsertdCasMINI-V4-NFZ-mCherry
UseCRISPR and LentiviralExpressionMammalianPromoterPGKAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hINSR-Venus1
Plasmid#248626PurposeExpression of the human INSR tagged with Venus1 for BiFCDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-NNG-Slug-nCas9(D10A)-PolI5MΔ
Plasmid#249079PurposeExpresses nucleus-localized NNG-Slug-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertNNG-Slug-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-Slug-nCas9(D10A)-PolI5MΔ
Plasmid#249078PurposeExpresses nucleus-localized Slug-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertSlug-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
HP17 sfGFP::P8
Plasmid#235448PurposeHelper plasmid with sfGFP gene inserted at gene VIII locusDepositorInsertCoding part of the M13KO7 helper phage genome, except gene VIII
ExpressionBacterialAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
anti-GCN4_scFv_GFP
Plasmid#244061Purposefusion of the SunTag binder (anti GCN4 scFv) to sfGFPDepositorInsertanti-GCN4_scFv_sfGFP_GB1
ExpressionMammalianAvailable SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only