We narrowed to 7,190 results for: cas9 plasmid

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#113691

U6 driven SaCas9 gRNA expression cassette followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Dec. 11, 2018

Academic Institutions and Nonprofits only

#113692

U6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Dec. 11, 2018

Academic Institutions and Nonprofits only

#64709

Co-expression of human codon-optimized Staphylococcus aureus Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells and other mammalian cells

Kiran Musunuru

May 14, 2015

Academic Institutions and Nonprofits only

#241307

3rd generation lenti vector encoding dCas9 (s. Pyogenes) fused with the VP64-p65-Rta(VPR) and a 2A GFP fluorescence marker

Robby Bowles

Nov. 17, 2025

Academic Institutions and Nonprofits only

#192664

3rd generation lenti vector encoding dCas9-KRAB-MeCP2 with 2A Hygro resistance marker

Jeffrey Miner

Dec. 14, 2022

Academic Institutions and Nonprofits only

#196717

CRISPR-activation. dCas9-VP64 with TagBFP for sorting.

Bernhard Schmierer

April 12, 2023

Academic Institutions and Nonprofits only

#242162

Lentiviral expression of dCas9-VPR with puromycin reporter

Amy Brock

Jan. 2, 2026

Academic Institutions and Nonprofits only