We narrowed to 16,648 results for: grn
-
Plasmid#131057PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pYJ14-PB-U6-ND1-acti-gRNA3
Plasmid#131058PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_UPF3A/UPF3B (pAVA3129)
Plasmid#239329PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting UPF3A and UPF3BDepositorInsertU6-driven sgRNA1 targting UPF3A and 7SK-driven sgRNA2 targeting UPF3B (UPF3B Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP64 (pAVA3500)
Plasmid#239237PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP64DepositorInsertU6-driven sgRNA targeting RMP64
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3547)
Plasmid#239240PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
ExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3555)
Plasmid#239242PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3563)
Plasmid#239258PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP64 (pAVA3572)
Plasmid#239259PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP64DepositorInsertU6-driven sgRNA targeting RMP64
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3583)
Plasmid#239260PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3584)
Plasmid#239261PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RPPH1 (pAVA3585)
Plasmid#239262PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-SOS1(dog)-gRNA1
Plasmid#228755PurposeA knockout vector for dog SOS1.DepositorInsertA gRNA targeting the dog SOS1 gene and the cDNA of CRISPR-Cas9 (SOS1 canis lupus)
ExpressionMammalianAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-SOS1(dog)-gRNA2
Plasmid#228756PurposeA knockout vector for dog SOS1.DepositorInsertA gRNA targeting the dog SOS1 gene and the cDNA of CRISPR-Cas9 (SOS1 canis lupus)
ExpressionMammalianAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Merlin(dog)gRNA1
Plasmid#214823PurposeA knockout vector for dog Merlin.DepositorInsertA gRNA targeting the dog NF2(Merlin) gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hEGFR_2b)-PGKpuro2ABFP-W
Plasmid#208432PurposeLentiviral gRNA plasmid targeting human EGFR gene, co-expression of BFP tagDepositorInsertEGFR (EGFR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hADAR1_1k)-PGKpuro2ABFP-W
Plasmid#208433PurposeLentiviral gRNA plasmid targeting human ADAR1 gene, co-expression of BFP tagDepositorInsertADAR1 (ADAR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U7Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only