We narrowed to 9,944 results for: siae
-
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1462
Plasmid#218623PurposeExpress mKate-TEV_cutSite_YFP to the peroxisome with low expression TEV proteaseDepositorInsertYFP
TagsePTS1ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1463
Plasmid#218624PurposeExpress mKate-TEV_cutSite_YFP to the peroxisome with high expression TEV proteaseDepositorInsertYFP
TagsePTS1ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB170
Plasmid#218591PurposeExpress engineered TFs Adr1c(S230A), Pip2c, and Oaf1cDepositorInsertAdr1
ExpressionYeastMutationAdr1(S230A), Pip2(1-168 + 2,497-2,988), Oaf1(1-30…Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1338
Plasmid#218592PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22DepositorInsertPex22
ExpressionYeastMutationPex22(1-36)Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1340
Plasmid#218593PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22. Also overexpresses Pex11DepositorInsertPex22
ExpressionYeastMutationPex22(1-36)Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB207
Plasmid#218596PurposeExpress degron assay: Degradation tag-YFP-ePTS1DepositorInsertYFP
TagsUbiY degradation tag and ePTS1ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM284
Plasmid#226122PurposeExpression of cdc48 E588QDepositorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pAM289
Plasmid#226126PurposeExpression of Npl4 D460K/Y461ADepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
paM291
Plasmid#226128PurposeExpression of His6-GST-3C-Npl4 T255A/T571ADepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM288
Plasmid#226125PurposeExpression of Npl4 W252A/R253EDepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM285
Plasmid#226123PurposeExpression of cdc48 W561A/Y562ADepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL194
Plasmid#222225PurposeExpresses site 1/Cas9/Eco1 RT in HIS3 locus.DepositorInsertsite 1/Cas9/Eco1 RT
UseCRISPRExpressionYeastAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL195
Plasmid#222226PurposeExpresses site 2/Cas9/Eco1 RT in HIS3 locus.DepositorInsertsite 2/Cas9/Eco1 RT
UseCRISPRExpressionYeastAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only