We narrowed to 10,447 results for: UTY
-
Plasmid#249733PurposeExpressing human ULK1-290-835 with a MBP tag in N-terminal and a mcherry tag in C-terminalDepositorAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pLCV2-AAVS1(hU6-sg1-mU6-sg2)-Blast
Plasmid#208343PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against AAVS1. Serves as a negative control by targeting a safe harbor locus.DepositorArticleAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCR8-CDK12
Plasmid#208347PurposeGateway cloning entry vector with CDK12. Must be recombined into a DEST vector for expression.DepositorArticleInsertcyclin dependent kinase 12 (CDK12 Human)
UseGateway: entry vectorAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab003-pcDNA3.1-FKBP5-3xFLAG
Plasmid#249006PurposeThis plasmid expresses the C terminally 3x-FLAG tagged FKBP5 protein sequence for pulldown assaysDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab525-pcDNA3-3xFLAG-V5-BRCA1(1314-end)-WT-STOP
Plasmid#249008PurposeThis plasmid expresses the N-terminally 3x-FLAG tagged BRCT domainDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab187-pcDNA3-BRCA1(1314-end)-WT-V5-3xFLAG
Plasmid#249013PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domainDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-mCherry:T2A:Bsd-EF1A-HA3xGShGLI1
Plasmid#249270PurposeExpression of GLI1DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL_GPR161-HA_V129E
Plasmid#249269PurposeExpression of GPR161 V129E mutantDepositorAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-RVdG-MCP:oScarlet-KASH_NoMBS
Plasmid#231014PurposeCVS N2c RVdG genome plasmid, utilized to generate negative control virus to benchmark the utility of MS2 tagging for capture of barcodes using snRNA-seq.DepositorInsertMCP-oScarlet-KASH
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBEL2809
Plasmid#232510PurposeExpression plasmid of Cys-light LetA(L94C,I383C) with LetBDepositorTags6xHis2xQH-TEVExpressionBacterialMutation[6xHis2xQH-TEV-LetA1(1-223,L94C,C124S)]-[LetA2(22…PromoteraraBADAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBEL2820
Plasmid#232511PurposeExpression plasmid of Cys-light LetA(Q180C,R380C) with LetBDepositorTags6xHis2xQH-TEVExpressionBacterialMutation[6xHis2xQH-TEV-LetA1(1-223,Q180C,C124S)]-[LetA2(2…PromoteraraBADAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-IB-H2B-PA-mCherry
Plasmid#247339PurposeExpresses photoactivatable H2B-Cherry under CAG promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-H2B-PAmCherry-FRT
Plasmid#247337PurposeExpresses photoactivatable H2B-Cherry under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR Gal4-UAS_3XFlag_4D5-5_CAR-mCherry_pGK_BFP
Plasmid#247572PurposeGAL4/UAS expression of a CAR against HER2 and mCherry with constitutive BFPDepositorInsertGAL4/UAS expression of a CAR against HER2 - mCherry and BFP constitutive
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTW411b
Plasmid#246583Purposedifferent combination of A. thaliana and N. tabacum Rubisco assembly factorsDepositorExpressionBacterialAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
2xmyc-RAB10 (T73A)
Plasmid#244984PurposeExpress RAB10 in mammalian cells with 2xmyc tag and T73A mutationDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
MBP-FUS-RGG3
Plasmid#243672PurposeExpresses MBP-tagged FUS RGG3 domain in bacteriaDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
6xHis-FUS-LCdel
Plasmid#243671PurposeExpresses 6xHis-tagged FUS with LC domain deletion in bacteriaDepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2784 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-20a CMV-BFP
Plasmid#240514PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-20 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only