We narrowed to 5,443 results for: mag
-
Plasmid#69585PurposeExpresses mutated p53-L344A tagged with mKate2 and split C-term mVenusDepositorInsertp53-L344A (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - C termExpressionMammalianMutationp53 L344A mutation that prevents tetramerization …PromoterEF1alphaAvailabilityAcademic Institutions and Nonprofits only -
pJL-mGold2s
Plasmid#231761PurposeExpression of mGold2s in yeast cellsDepositorInsertmGold2s
ExpressionYeastMutationmGold2s is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterpTDH(GAP promoter)Available sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-DelFSH(307-309)-pKK223
Plasmid#131377PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with deletion of residues FSH 307-309 in Gs MutY.DepositorInsertEcNGsC MutY chimera DelFSH(307-309)
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable sinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344A-mKate2-splitmVenusN
Plasmid#69584PurposeExpresses mutated p53-L344A tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344A (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344A mutation that prevents tetramerization …PromoterEF1alphaAvailabilityAcademic Institutions and Nonprofits only -
pJL-mGold2t
Plasmid#231762PurposeExpression of mGold2t in yeast cellsDepositorInsertmGold2t
ExpressionYeastMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterpTDH(GAP promoter)Available sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mEGFPm-IFNAR1(28-557)
Plasmid#192704PurposeExpression of SNAPf and mEGFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and meGFPm…ExpressionMammalianMutationmeGFPm: gluatmic acid 142 to asparagine and histi…PromoterCMVAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based no force control)
Plasmid#118720PurposeThe acceptor (mCherry) only control for the no force control of the F40-based human desmoplakin II tension sensor can be co-expressed with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)(Y67G)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y67G mutation in YPet(sh…PromoterCMVAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPm-IFNAR1(28-557)
Plasmid#192784PurposeExpression of SNAPf and mXFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPmExpressionMammalianMutationmXFPm: tryptophan 66 to phenylalanine, gluatmic a…PromoterCMVAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH005_phiC31_neo-core-5xTetO-pEF-H2B-mCitrine-core-pRSV-H2B-mCherry
Plasmid#179433PurposeDual fluorescent reporter construct with double core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertcoreHS4-TRE-cit-coreHS4-mch (DC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL008_phiC31_neo-5xTetO-pEF-H2B-mCitrine-5kb,lambda-pRSV-H2B-mCherry
Plasmid#179426PurposeDual fluorescent reporter construct with 5kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-5kb-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH010_phiC31_neo-5xTetO-pEF-H2B-mCitrine-1.2kb,lambda-pRSV-H2B-mCherry
Plasmid#179427PurposeDual fluorescent reporter construct with 1.2kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-1.2kb-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.2 (AAV1)
Viral prep#111069-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-dLight1.2 (#111069). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.2 plasmid DNA. CAG-driven expression of dLight1.2 dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorAvailable sinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based tension sensor)
Plasmid#118719PurposeThe acceptor (mCherry) only control for the F40-based human desmoplakin II tension sensor can be co-expressed with the donor (YPet(short)) only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II-[YPet(short)(Y67G)-F40-mCherry] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)(Y67G)-F40-mCherryExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-GECO2G (AAV9)
Viral prep#159605-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-NIR-GECO2G (#159605). In addition to the viral particles, you will also receive purified pAAV-CAG-NIR-GECO2G plasmid DNA. CAG-driven expression of the near-infrared calcium indicator NIR-GECO2G. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable sinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-ChrimsonR-mCherry (AAV1)
Viral prep#92207-AAV1PurposeReady-to-use AAV1 particles produced from TRE-ChrimsonR-mCherry (#92207). In addition to the viral particles, you will also receive purified TRE-ChrimsonR-mCherry plasmid DNA. TRE-driven ChrimsonR-mCherry expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterTRETagsmCherryAvailable sinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-GECO2G (AAV1)
Viral prep#159605-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-NIR-GECO2G (#159605). In addition to the viral particles, you will also receive purified pAAV-CAG-NIR-GECO2G plasmid DNA. CAG-driven expression of the near-infrared calcium indicator NIR-GECO2G. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable sinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only